Wheaton College - Nike Yearbook (Norton, MA)

Text from Pages 1 - 140 of the 1947 volume:

a . i Fi A , A WANS ¥ft F ) | a he eh Views eS ae a oe “ oS ee ee + ‘ es a 3 a — a —= = rae z, ; Fg | 1 OT! 7 WA a +2; ; , Vy , i AB, eth iy t } yi } SN OA ES we = RET a ee te = 3 é aces Ss tc Be IR SERS SRS : = S.A SSS ‘ SSS We will forget so much, Almost as though In single file and shame-faced, our small years Were marched away, | And we who watched them go Forgot the faces, Never knew the fears... Fragments of time best dealt with are the few That memory hold vivid, And the mind Remembers with clarity of view Familiarity, As though not hard to find In what we call the past; These are the things That time treats kindly; If we keep them near In pages of a book, the memory brings An image Veiled by each succeeding year. S Page four GOOD SHOW is a lasting pleasure that remains with usin two ways. The first we hardly realize but the echoes of our laughter linger with us and cheer us though it be faint and near forgotten. The second way we take delight is in the re-telling of the story and the vivid recollections of scenery and music. In these ways our college years live with us. The undercurrent of long-gone days endures in our hearts and in- voluntarily makes evenings more peaceful and mornings bright- er. The memories of our friends and surroundings at Wheaton are the greatest pleasure, for the image of one face may prove dearer to us than all the lessons we have learned, and the voices of those we knew return, sweeter than a graduation song. Here are written the names we spoke, and in these pictures are the shadows of the girls we once greeted. This book holds the mem- ories which remain our chief delight. Yi N : é H AWS ee ee LAOS - ENE awe Osx ec Sos RE” “teenie Soe ON e! a bs eet PL A ie? . oe : oaks gat si is a ete er ad th ew ed a a ae Page ten We dedicate this year’s Nike to Dean Eleanor Barker in an attempt to express our appreciation for all her courtesies and kindnesses to us. AI- though a major director of the college’s three- ring circus, she has not let her position take away her faithful interest in our student activities be it from class hockey games to a meeting of IR C. We have had many meetings with her in her office under the Ad building’s big top but whether our meet- ings were for advice or reprimand, we have always come out being all the better through her reasoning and experience. Her trust in us as students and as in- dividuals has been expressed in her encouragement of an Honor System at Wheaton. Miss Barker acc epted the position of Dean during the war years of 1944-45 so she therefore had the added responsibilities of certain wartime restrictions added to her regular offices. The continuity of our college life was consider- ably eased through those high tension years by her quiet guidance. Now that we have entered the post war period she has been among the first to try and re- turn Wheaton to a prewar basis. In thanks to her recognition and just appraisal of our problems we dedicate this yearbook. Page eleven : aks is te cee Sv (alsa ad PRESIDENT MENEELY Although he is a “Junior” member of the company, President Meneely has been the ringmaster of that “Greatest Show on Earth,” Wheaton College, since he arrived in 44 as Director of Main Features. He has also contributed to the side shows of campus life which direct us toward a great- er appreciation of life’s values. Doctor Meneely is not only a symbol of the austere closed office door. To each of us he means something special, and when he speaks, no matter how large the au- dience, there is always the sensation that he is speaking to any one person. But Doc- tor Meneely is more than a personal ac- quaintance. For two years we have been passing from the throes of a war-torn world, searching for faith to guide us through the instability of post-war years. Dr. Meneely has pointed the way to go. ‘ His principles, the necessity of an open mind, judging and examining both sides of a question, we will take with us. He has shown his trust in us by estab- lishing an honor system applying to all ac- ademic work. We hope that we have in the past and will continue to justify his faith. Page fifteen DEAN Miss Barker THE MANAGERS DIRECTOR OF ADMISSIONS Miss Townsend Page sixteen ANY of us shall remember the Ad- ministration for their advice and for their adjustment of our many problems. Some of us will remember them for the bills they sent us. All of us, though, will remem- ber their friendliness to us during and after the years at Wheaton. Managing a troupe of some five hundred members from five differ- The ef- ficiency with which Wheaton is run is evi- ent points of view is no easy task. dence of their good coordination. She has a taste for antiques but her ideas are not old fashioned. Dean Barker always has some new angle to offer. Miss Olinder in the outer office aids in putting the new ideas into action. She also signs those valuable tickets for a weekend at Dartmouth or Yale. Pink slips, white slips—not from the in- firmary but from the Dean of Finances, Miss Dunkle. _motto to be pink bills for poor people—that Although some might believe her is not so. At certain times of the year “Pop” BURSAR Miss Dunkle would prefer that Miss Dunkle forget us but unfortunately she has the memory of a circus elephant for bills. However, bills are not the only things she collects for even the President has delved into her collection of private jokes. For a newcomer to Wheaton’s circus, Miss Noyes has behaved like a real trouper. Skepti- cal that she might try to regiment us into the Waves, we are relieved to report that she has not even ment ioned it. She does very well getting to academic appointments. on time being a Frosh—but why not, she makes them. Our thanks to her for straightening out our courses so that we do not graduate a Math major instead of an English major. Miss Townsend sees more girls’ faces than practically any of the administration but she still can tell us one from the other. One does not have to look far to see that her selection of Wheaton students is tops, end of quote from 99.9% of the Faculty. REGISTRAR Miss Noyes Page seventeen Where would the big tent be without the stakes? Or, if you prefer, what would Whea- ton be minus the staff? Who would sit behind the bars and issue the bright orange admission tickets? Who would tie down the canvas and prop the bleachers? How could the clowns get their makeup on straight and the barker compose his script? And who do you suppose would bolt the lion’s cage? Your 130 I. Q. (Waltzing Elephant Level) has hit the jackpot! As Wheaton displays her glowing countenance to one and all, it is no one but Mr. Fillmore and the ground crew who oil the spokes and trim the corners. With- out their help there would be a foldup before the next matinee! How would we exist with- out Mrs. Pratt who keeps our complexion at a low ebb and our intelligence at a status quo? Page eighteen As she rubs her magic wand we have all that our plaintive voices desire. Though we take our woes out on our food, we are heartily grateful to Miss Lincoln and Miss Billings who, if they will forgive our gripes, keep our tem- pers calm as they supply the basic need of man or beast. Casting aside delusions of grandeur, with all of our ideals, we can’t deny that it is the box office of Miss Dunkle and her staff that stakes the canvas to the ground. And all the many others who do the countless small jobs that we know nothing about, the voice of Miss Dunham who directs us when Wwe miss a train, the secretaries who make the Ad Building buzz, and store our records, we hope in forgotten corners. - Each one takes part in the circus parade. ee x Put up the nets, string the tangled ropes into a neat pattern that will catch the tum- bling trapeze artists as they climb along the swinging bars. Shout instructions to perfect their acts and. give grace and continuity to their actions. These are some of the many and varied duties of the faculty. They weave the designs of intellectual understanding into the unformed and searching minds of the stu- dents who climb through the air. They ad- vise as to the twists and turns and short cuts that will give the performers the dexterous appearance of professionals. And they open up avenues of exploration for those who wish to climb to the top of this three-ringed circus. They are kind, big-hearted people who want to give their knowledge, to set it to work in order to build other circuses and to put nets under all the erratic climbers of the searching world. Instead of the uniformed attendants of Barnum and Bailey who change the settings of the arena and help cage and uncage the animals, Whea- ton’s attendants are like a many-colored kalei- doscope that changes hue with the encircling sun, and place their props with deft hands and minds of intellectual perception into neatly Page twenty labeled boxes filled with crossword puzzles. They have the keys to a life that is new and better, old and worth remembering. They have all the things that make Wheaton a real circus, a great performance. . .the “greatest show on Earth”. When you hear the jingle of keys coming down the long corridor of the Science Building, it can mean only one thing, Dr. Lange is ap- proaching. As head of the Zoology Depart- ment Dr. Lange not only lectures and super- vises laboratory work, but spends most of her spare time tending the ill-fated chickens of many a forgetful student. Her well-stocked mind leads the students into many interesting and colorful conversations over a cup of tea brewed on a Bunsen Burner. Unwrap your fingers from your tired pen- cil, cram your fifteen pages of notes into an hour lecture that might easily have been three, and you'll know you’ve just had a ses- sion with Dr. McCoy. But compensating for this fatigue and the endless hours with cats and formaldehyde, is Dr. McCoy’s charming home that becomes a haven for the harried Zoo majors. To the student who is interested in what makes a turtle tick or a salamander spawn, Miss Chidsey is the gal for you. And when indoor exploration leaves you cold, Miss Chidsey will take you down to Woods Hole. If plants give you palpitations, patter along with Miss Leuchs and Miss Barrows. Across the woods and fields you fly to find many plants and trees to identify. Calculate, theorize, contemplate, organize. . . all this is found in the physics you took when you were lectured by Dr. Shook. A two-wheeled bike will lead the way to where Dr. Evans would like your mind to stray. Miss Marshall will be there, test tubes will clink, filled with innocuous liquids that no one would drink. If it’s dramatics you want, go to Miss McKee who combines a poor memory for the mundane with an enthusiasm for acting which is open- ing up quite a few eyes. A walk in the woods will doubtless bring you face to face with Mr. Ramseyer, the aesthete who strangely manages to get down to business in a classroom, and a stroll through the library will bring an encounter with Mr. Cressey, fact finder of the Socialogists. No circus performer is equipped until she is adept in languages, well, at least one. Wheaton’s circus offers many artists to help you with the act. Miss Littlefield will take time from the freshmen to teach you the nack of bonvivant in French. If speaking Spanish fluently is your ambition, Miss Breton with her pep and vivacity can charm you into Don Quixote in no time. No good performer is finished until she ‘“‘understands Russian”. Dr. Vakar will help you learn Russian and “under- stand Russia” at Marty’s any Tuesday after- noon. Page twenty-one The faces above you look bland and smiling but carefully hoarded behind those pleasant masks are statistics, figures and theories which know all about YOU! They have us Tagged for memory, motivation, flights into fancy and Freudian slips of the tongue. Somehow, however, in the midst of their mazes, graphs and figures, they have all managed to main- tain their own identity. You can’t miss Mr. Shipley. . -he will be carrying a raincoat and supporting a cigarette but not smoking it. If you are still not sure, you cannot miss the long, low “Hi”. To find Miss Rickers just hunt for someone much to peppy to keep up with, speaking fourteen syllable words in fourteen languages. . .all with a Russian accent. Famous for any number of things, we will remember her for eye opening lectures, brain crushing exams, Slavka, her tempermental convertible, and irresistable charm. Miss Amen, famous for her hospitality and cookies, is head of this perspicacious crew. She is wonderfully friendly, as she tries to make budding Gesell’s out of all of the majors; but we harbor a suspicion that her heart belongs to the nursery school. Speaking of the nursery school, we can’t mention the Psych Depart- ment without a few words of praise to Miss Brooks, Miss Fleisher and Miss Thompson who manage to keep things calm and their charges happy while the majors busily observe their activities through a one way screen. After we have learned all there is about the small children, we go on to Mr. Nourse who, Page twenty-two with his kindly manner and slow drawl, in- structs us in the ups and downs of teaching. If you like coffee at Marty’s, a good sense of humor, and the Brooklyn Dodgers, you can’t help but know Miss Schonbar. Life in the classroom with Miss Schonbar is refreshing and informative; life outside is full of laughs and amazing numbers of friends, Wheaton has always been famous for her English Department, and four years of good, solid reading and listening will verify her rep- utation. Mr. Sharp is the head of the Depart- ment, and as such is an inspiring combination of wit and erudition which makes his classes a “must” on any major’s course cards. Mrs. Boas loves a “‘well stored mind”, and there is no better example than her own. Keeping up with Mrs. B. is no less than a mental marathon, but somehow when the bell rings she never seems out of ideas. She is alert and so quick that she can make any of us feel stodgy, but her effect on us is as stimulat- ing as a cup of coffee, and she makes us want to run home and read and read and read. Mr. Earle brings us the quiet, Thoreauean contemplation, and his continuous search for new ideas makes his classes delightfully like a symposium, We can think of no one who more carefully and hopefully merges knowledge of the past with hopes and plans for the future than Mr. Earle. Probably the most quoted man on campus, he makes us think and actual- ly enjoy doing it. When we see Miss Vickery we start cor- recting our grammar and envying her her Aus- tin. Mixed in with grammar, journalism and poetry is a subtle humor which tests your wit as thoroughly as her exams do your knowledge. If you think that English professors have naught to do but read all day, you don’t know Miss Burton. Her name is on countless com- mittees and her lectures cover such wide areas that they assume the aspects of a travelogue. Interesting things always seem to happen to Miss Burton, and if they don’t come to her she runs out to find them, after which we go to her class for some vicarious living. Mr. Glasheen tries to live a quiet life on Howard Street with his wife and baby, but somehow things can never be too quiet for Mr. Glasheen. He thunderbolts his classes with amazing quotes and quips and his lectures have the tone and quality of an animated New Yorker, but we know very well that it was a little north of New York that he amassed all that learning. If you want to know about the past to pre- pare for the future go to the History Depart- ment, who are more than equipped to teach you all you want to know. Mr. Knapton, with his eternal pipe and Oxford charm, can give you an understanding of people and na- tions, along with a thorough history of the world. If it is America you are interested in Miss Clewes and Mr. Hidy can give you two different, but equally stimulating, aspects of our country. “Miss Clewes, renowned for her lovely hands and subtle sense of humor, gives you the cultural viewpoint of our history and our ancestors. She is always willing to discuss events past and present over a cup of her much needed coffee at Marty’s. Still retaining his Navy dash, Mr. Hidy expounds on the eco- nomic history of our country. Surrounded by innumerous maps and text- books, calm, ever smiling Miss Gulley fills her classes with interesting bits of information and a broad-minded viewpoint toward history and life. ‘The newest acquisition of the De- partment is Miss Sylva. Not long out of col- lege herself she verifies the theory that new professors expect perfection from their stu- dents. Although she doesn’t quite get it all from all of her students she gives it to her classes. If you have any questions about: government go to Miss Sylva. She knows all of the answers. Although they devote most of their time to their majors they manage to find a little to keep the rest of the community up on the news, with their interesting weekly lectures on current events. So if you want to know about life as well as history go to the History Department who, with their combined talents, can give you more than the price of a ticket of admission. TRHESGEASSROR Zo The class of 1950 entered the ring on the 17th of September, 1946, with a blare of trumpets and speeches of welcome and warn- ing. Confusion and chaos reigned for the first two we eks but after the novelty of being new little ponies in the ring we got used to the cracking whip and confusion disappeared. Although we tried to be very sophisticated, we realized how much we had to learn in order to become accomplished performers. ‘The maze of rules that complicate college life, how to study to make the most of our precious time, CLASS OFFICERS—Barbara Smith, Roseann Heim, Vir- and all the other things that make up the great ginia Pennel, Nancy Whitelaw, Dorothy King circus. Yet we were told, during the first Zelda Friedman, Ellen Gundersheimer Carol Blake, Ann Talbot, Car ol Swaney Marie White, sEdith Engler, Irma Clebnik, Jean Fischer, Phyllis Sloane, Cris Kringle Nancy Whitelaw, Natalie Rowland, Phyllis Hughs, Nancy Hoff Caroline Brown, Hattie Coleman Beth Bradt, Nancy Lanison Page twenty-six week by everyone who spoke to us, that we were by far the nicest class that ever entered the ringside at Wheaton. This we took with a grain and a half of salt, and wrote proud letters home to our equally proud parents to tell them about it. We wondered, if competition was so terribly keen, just how we came to be here, in spite of our obvious beauty, brains and sophisticated bearing. The spotlight focused on Hattie when she brought down the house as well as the Harvard Dra- matic Club with her rendition of Emily in Our Town. This wasn’t Hattie’s first glimpse of foot- lights at Wheaton; she directed and acted in the freshmen skits that made Metcalf famous. Toward the middle of the year, the freshmen class shook off the whips of older trainers and hunt- ed for leading ability in its members. Nancy, Gin- ny, Dotto, Barbie, and Rowie have put us through our paces ever since. We are still understudies for the big parts. They loom before us in their sparkling settings with the radiance of jewels in a crown. They seem un- attainable. And we wonder if we will ever be able ‘to make the grade. But we feel that we have the talent and the ability to join the long parade and be the stars of tomorrow. Margaret Brown, Eleanor McCrudden, Mimi Gherardi, Joan Chilcott, Virginia ‘Lowery, Ruth Nelson, Virginia Pennell, Emily Nichols, June Marion, Joan Miller Marjorie Paisner, Ann Cudner, Mary Cunard, Carol Doyle, Sally Ann Budgell, Virginia Rapp, Zelda Freedman, Edith Engler Mary Cunard, Joyce Merrick, Ann Cudner, Christie Arnold, Frances Morse, Margaret Heineman, Jane Brown, Mary Ellen Burgess Mary Hurlbut, Muriel Macbain, Doris Kinzel, Sally Ann Budgell, Virginia Butler, Nancy Buckley Betty Steinberg, Nancy Jacobs, Nicky Wei- land, Phyllis Hughes, Jane Brown, Nadine Lane Lois Caldwell, Jocelyn Sewell, Emily Frum, June Baker, Jean Campbell, Nancy Iddings Page twenty-eight : d Nancy Corwin, Ruth Alt, Jean Kearney, Sally Albright, Carol Ott, Marjorie Paisner, Dorothy Ballysingh, Beverly Higgens, Virginia Scatter good Elaine Hager, Carol Doyle, Jackie Cohen, Marjorie Paisner, Nancy Robb, Pat Silmore, Permelia Bayol, Ellen Gundershermer Phebe Brodeur, Ernestine Shea, Nancy Betty Ennis, Nancy Roland, Shirley Ellen Ordway, Nancy Shurtleff, Nan- Davis, Nancy Whitelaw, Caroline Rice, Reed, Ann Pattison, Mary Seiberling, cy Cherrington, JoAnne Benninghoff, Sally Sprague, Jand Delacy, Eleanor Jean Baily, Mary Hayes Mary Ellen Whitfield, Sally Albright, Laird, Marilla Otis Nancy Corwin, Roseann Heim Page twenty-nine THE CLASS OF 1949 CLASS OFFICERS—Barbara Holden, Lloyd _ Phillops, Betty Garrigues, Joy Merritt Jean Evans, Barbara Nann, Kathie Shea, Dotty Soest, Marion Metcalf, Jean Eberhard, Lynn Elias, Nancy Johnston Jane Hering, Alice Feuer, Louise Taylor, Jean Johnson, Ruby Watson, Clare Babb, Jill Steiner, Gloria Buda, Jackie Servais Page thirty Summer vacation has ended. Our main attraction was along the line of It had been all too short, but what fun it sports. As freshmen we won the cup, but as was to be back, no longer the little freshmen. sophomores, we deserved it even more. Barb- 25 We moved off fourth floor; we stopped m ak- ie’s name was engraved on the tennis cup for ing conscious efforts at being sophisticated; the second year. Our half of the Blue team helped cop the hockey championship. We ended the basketball season undefeated for the second time. We took first place in the riding we learned to precede freshmen through doors with a touch of arrogance; we helped break down justifications for cries of “lethargy!”; we . cate . m. more. ur swimmer 1 began to voice our ideas and opinions without PAE OL os regs IOS ers brought in more victories. Janie and Bea were elected to fear; we were sophomores. the all-college team, and Janie was a delegate With Bea as ring master and Lloydie, Kay, PoE TeenebGre: Joy and Barbie as assistants, we made our own three-ring circus. And there was much to be proud of. Jean Fetter, Marilyn Keach, Jean Jean Seaton, Amy Wright, Sally Scheidenhelm, Mary Joe Stuart, Jean Stevens, Fifi Richardson, Betty Tufel, Phillips, Sue Ripple, Ginny Vogt, Peggy Spring, Ruth Hansen Barbara Bigelow, Ann Neilson, Ticky Fellows, Jean Gray E. K. Keller, Mary Louw Scott, Molly Storb, Marion Lanphear, Jane Hess, Ginny Barbara Bayne, Betty Ann Owens, Barbara Holden, Mary Griffith, Joan Lund, Biggers, Sue Williams Kay MacKay, Irene Lofgren, Janet Ann Sperry, Emily Renwick McCutcheon, Betty Saber Page thirty-one The ring of activities was a busy one. News, C. A., D. A., and C. G. A. had staunch supporters from our class. Kathie made Mrs. Webb a real New England woman in Our Town. Angie and Murph sang more beauti- fully than ever. We all moved forward to take our places of responsibility and to pre- pare for even bigger and better jobs next year. And, somehow, we managed to have a large representation on the Dean’s List, too. Marga- rita and Skip won the cherished opportunity to study abroad. The third big ring in our life was the social one. Ootsie made a super-lovely May Queen Kay Reynolds, Betty Clegg, Mildred Koch, Carley Barer, Cornelia O’Dowd, Barbara Murphy witha nisi aoa adbeast ae wae SAP Maal ema Dene AU imnmwe ane a “ with Betsy and Sue striking copper and coal attendants. We were proud of our new class rings, but Janie’s sparkler set us to wondering who would be next. We gasped as we count- ed the number of freshmen who were ahead of us. We used up our two late pers and wished for more. We discovered new places to go and We had fewer “blind” dates, and more of us had found “‘the one”. new things to do. Once in awhile we did remember the warn- ings of elders about a sophomore slump, but we rode atop the lion’s back and kept flying in the air without a spill. And now it’s summer again. Jean Ward, Donna Ford, Barbara Fellner, Adel Yaffo, Nancy Lumbert, Frances Jones, Donna Valley, Judy Miller Joy Merritt, Betty Sites, Pat Dan- zer, Esther Speidel, Beverly Brand- wine, Connie Cohen, Buzz Reid Eleanor Cox, Sally Neff, Nancy Brown, Gene Brobst Brenda Ryan, Katherine Schmidt, Evelyn Newcomet, Persis Heywood, Jean Schabacker, Gay Clark, Margie Knust, San Speer Page thirty-two Alice Hewett, Martha Gleason, Shirley Whip- ple, Audrey Newton, Jean Purinton, Mary Lynch, Claire Anderson, Midge Penfield Lois-Mary McFall, Caroline Simons, Ann Rice, Ginny Clark, Joan Henderson, Lloyd Phillips, Betsy Bird, Betty Garrigues, Marian McIver Page thirty-three s 4 4 4 “ «. fe oS Be we ee CLASS OF 1948 What’s a circus without rings? Most tents only have three, but ours is most remarkable because there are four, all so full of activity that it’s impossible to see everything that goes on in each. But let’s follow the spotlight around to number three; what a display of jolly, jolly juniors, class of °48! We are gay and we are sober, happy that we have a year to be part of the show before we don our cap and gown, and serious as we realize the respon- sibility that will soon be ours. We came back realizing that some of our best performers were gone; Tish, Vangie, and several more. Some we'll see again next year after their sojourn in Switzerland; Betsy, Jean, Mary, Marty, and Carol, as they add their touch of cosmopolitanism. Still others have left, leaving the many for the one. Amelie turned her ideas on Nike over to Bonny to carry on. Willy, Lee, Mary Lou, and Liz have also swapped Pegasus for a narrower band. Next year, with pins and rings multiplying well pass on a few more. Connie McCollum, Lee Arnold, JoAnne Ding- well, Virginia Wallace, Jane Drury, Pat Spenser, Trudy Campbell, Mitzi Mitchell Sue Lawes, Bev Yeaple, Mary Richards, Betty Arnold, Lee Arnold Page thirty-six Shirley and Ginny take the center of the stage helping Elly with C. G. A. Sue takes over and Til minds the funds for C. A., while Peggy and Mitzie, along with Dottie, give us those spectacular performances starting off with Our Town. Iz and Betsy keep us at the physical fitness routine, which isn’t a bad idea after we take in those houseparties at Brown, Dartmouth, or Harvard. Speaking of sports, we may not win the games but our players belie the score; Ginny Wallace, Barrie, and Katy flashing the hockey sticks, Gush managing the horses, Cici with her dancing, and lots of others. Brawn and brain work together as Audrey pulls in top averages with more of us tipping the balance. Mel carries on the efforts of But- ton in working towards a united world. After such a strenuous year our tired brains shake up the sawdust as we slip into our booties and pinafores, lose those inhibitions that come with age and reveal to all the world and Wordsworth that the child is the father of the man. And so we'll leave our charges, after help- ing them through the rings, and Bev will lead us on to our days of sobriety. Jean Bruce, Jane Drury, Barry Reid, Lois Shaw, Rit Ritter Titch Steel, M. E. Shreve, Daphne Fay, Eugenia Tinajero Page thirty-seven Mary Cushing, Reggie Baker, Pat Colvin, Timmy Stillman, Mary Richards, Jean Mac- Dill, Shirley Shapiro, Bobby Halle acy Janet Cheever, Micky Rimbach, Betty Single- ton, Patty Pieper, Nancy Cook, Peggy Duffy, Consuelo Eames, Jackie Greiner, Marilyn Miller D. J. Meyer, Ginnie Oliver, Joyce Tyler Page thirty-eight Coughlin, Nancy Shirley Johnson, Jean Sullivan, Lois Meyers, Ginny Hunt, Nat Moore, Ceci. Kuehnle, Jane Dodds, Elizabeth Jevdet Betty Hastings, Til Snelling, Mrs. Ewing, Nancy Taylor, Dot Hussey Carol Steinbring, Bonnie Brockway, Ileane Kliman, Mary Renwick, Dotty Woodman Priscilla Dattman, Evelyn Masi, Jean Bricker, Helen Caracuzzo, Cornelia Buck, Joan Strat- ford Titch Steel, M, E. Shreve, Renate Lieberg, Lois Shaw, Nancy Hauser, Betsy Helen Bolton, Peg Carey, Mary Lou Gagney, Anne Hering, Janet Maul, Rit Ritter, Jean Bruce Jane Rossiter, Audrey Farrow Corkran, Joanna Harrison Page thirty-nine SENIOR After four years on the same run the act is splitting up and heading for the big time. We’re sorry to leave a company we’ve done so much with, and so well with. We've tried to have a finger in every pie and our best manager material has been managing the specialty acts since we joined the troupe. What would Vodville have done without Gumble and Rushlight without Rozzy Jean Haller Wiffie Oliphant and Asch and how would we know anything about the Art Center without Libby. The M. C. is a product of our Page forty-two CLASS og own short-training-course for C. G. A. presi- dents. Our Ellie, she walks, she talks, she’s terrific. We're the first act to feature a vete- ran of the world show, we’re that proud of our Rusty. We'd have been lost without Bobby Schott who’s been an officer of some description since we began and has been in stel- lar position this year. Dottie has handled our drama angle ably; Bobbie A. and Bobbie L. have kept us knee deep in news. All in all we're ready to show the world how we can knock ’em dead, whether in careers or with that certain male. In our four years social life has changed from a world of women and an_ occasional uniform to a hilarious riot peopled with tweedy, brush cut, pipe-smoking Yale men and an occasional woman. For the first time we saw a traffic jam on Howard Street, and tried to go to t hree different football games with three different wonderful men. Business is business and we have spent a good part of our valuable last days holed away in the libe so we could win any argument from Seminar to Marty’s. We pass one last parade before the reviewing stand. It’s taken us four years to perfect the act— and it’s been hard work, team spirit, blood, sweat, and laughs, but we think we made it. Now to see how the world takes us. There is something so comforting and protective about our home, the Big Top—it’s tough to leave and tough to miss the fun, but it’s not “goodbye,” kids, it’s “On with the Show.” Bobbie Schott Lidge Titus Ginny Dunbar Page forty-three ANTHONY, BARBARA JANE ASCH, BARBARA BATES, NANCY GAIL Milford, Conn. New York, N. Y. Yonkers, N. Y. Hist. Gov’t English History Page forty-four ADAMS, CAROL GILCHRIST AGLER, CAROLINE LEACH Wynnewood, Pa. Youngstown, Ohio. Music Psychology BAVICCHI, PALMA ROSE BERG, PATRICIA FRANCES BOGHOSSIAN, ESTHER MARY Dedham Buffalo, N. Y. Pawtucket, R. I. English Psychology English Page forty-five BOTHFIELD, LAURA BRAND, NORMA ANITA Wellesley Hills Woodmere, N. Y. Sociology English BROWN, LOIS JO ANNE BROWN, MARGARET BROWNELL, MART FRANCES Worcester Scarsdale, N. Y. Bridgewater, Conn. Psychology Sociology Mathematics Page forty-six ee o f a Za 2 aio 5 ba % ae OE Agg Z83 § ro ops oy m-2 fH AY = O a GG Ms pig ree 23 =H Ge) Ags ave sare alse aa oe 5 - Q BURCHARD, ANN Scarsdale, N. Y. English CORY, MARY LOU CROWELL, MARGARET CURME, FLORENCE LOUISE Englewood, N. J. Reading White Plains, N. Y. Psychology Psychology English Page forty-eight CHARLES, MARGARET SKINNER COLIVAS, CLIO : Reading Belmont Zoology Art Oo 47 DINGMAN, MONNA ELIZABETH DOERR, MARY JANE DOLAN, BETTY ANN Palmer Baltimore, Md. Earlville, N. Y. English Spanish Economics Page forty-nine DRURY GHARLOTEE=PETERS DUNBAR, VIRGINIA Maynard Dallas, Texas History Art The CLASS DUTTON, MARY EVELYN FLETCHER, NATALIE FORD, LAURA ROSEMARY Portsmouth, N. H. Worcester Haddonfield, N. J. Psychology Economics American Civ. Page fifty lez 4 7. of CAROLYN JOSEPHINE Wellesley H FRIEDMAN, PHYLLIS LOUISE ’ FRANKE FRAAS, JANET LOIS New York, N. Y. ills Fitchburg History Psychology Botany Page fifty-one The GiASS GASH, ROBERTA KING VIRGINIA CHRISTIAN GOFF, MARY-ELIZABETH Newport, R. I. GATEWOOD, Brookline Sociology Richmond, Va. English History Page fifty-two FULLER, PATRICIA ADELAIDE GARDINER, BEVERLY ANN Wakefield Saylesville, R. I. Psychology German on 1947 GORDON, RUTH LENORE GREENE, ELIZABETH PEMBROKE GROSSMAN, SYLVIA IRENE Brookline Nanuet, N. Y. Brookline Sociology | English Psychology Page fifty-three GUMBLE, RUTH PATSY Columbus, Ohio History HAYES, DOROTHY HELEN Brookline Art Page fifty-four AaB HALLER, JEAN FRANCES Needham Art FACIE ELIZABETH JARRE LG HEINEKAMP, AILEEN DOROTHY HEATH, Trenton, N. J. Philadelphia, Pa. Physics Art HOLDEN, MARY .ELEANOR HOYT, ANN HUTCHINSON JOHNS, MARTHA ALLEN Shirley Center Stamford, Conn. Richmond, Va. Philosophy Zoology English Page fifty-five KENT, BARBARA EATON KING, ELIZABETH GREENOUGH KING, MARY ELIZABETH Dedham Upper Montclair, N. J. Upper Montclair, N. J. | Psychology American Civ. Psychology Page fifty-six KAHN, BARBARA CAROLINE KENT, ALICE STEVENS ; Rockville Centre, N. Y. Dover Hist. Gov’t. Art of 1947 Sa ON ea Lato aR KREH, AUDREY STANLEY LORD, MARION WINIFRED LYNN, BARBARA Elizabeth, N. J. Maplewood, N. J. Larchmont, N. Y. Psychology Psychology English Page fifty-seven MACNUTT, MARJORIE ELEANOR MADDOX, JANE DE LAITTRE Stockbridge Norwood Psychology English The GEA MAYNARD, PHYLLIS GRACE McCANN, LOIS ELIZABETH McCLOSKEY, ANN ELEANOR Lexington Rome, N. Y. Norristown, Pa. Economics Psychology Chemistry Page fifty-eight McCLURE, JANET FRANCES MORTON, JEANE AUDREY NAGANO, MOMO Pelham Manor, N. Y. Wynnewood, Pa. Los Angeles, Calif. Economics Psychology History Page fifty-nine The CLASS PIERSON, MARGARET NORRIS RABE, NANCY OLSON, MERTICE Akron, Ohio Darien, Conn. Waltham Psychology Biology Zoology Page sixty ODLIN, JOAN STEARNS OLIPHANT, HELEN GILL Worcester Trenton, N. Y. Sociology History of 1947 RENOUF, LOIS WHITAKER REPLOGLE, JEAN REX, BARBARA CLAYTON Pittsfield Mount Kisco, N. Y. Chestnut Hill, Pa. English English Art Page sixty-one RHODES, GWENDOLYN ANNE RICHARDSON, ANNE North Chelmsford Scarsdale, N: Y. English American Ciy. ROBINSON, MARY LOUISE ROTH, ROSLYN KAY ROSS, JANET Falmouth Roreside, Me. New York, N. Y. Lexington Chemistry Philosophy Psychology Page sixty-two p74 7 of SCATTERGOOD, JEAN SARRIS, THEMIS ATHANASIA RYDGREN, DORIS Page sixty-three Edgewood, R. I. Psychology Amherst Art Wilmington, Del. American Civ. e SHERMAN. MARY HELEN SHERTER, CHARLOTTE SIMONS, MARJORIE FRANCES Bar Harbor, Me. Newton Centre Dalton Zoology English Biology Page sixty-four Y SCHOTT, BARBARA SHEETS, CAROLYN SLOAN Rumford, R. I. Yonkers, N. Y. Economics Philosophy SOUTHWICK, ELEANOR SPARFIELD, FLORENCE MASON STURENBURG, CONSTANCE ALICE Middleboro Buffalo, N.Y. Newton Highlands History English Chemistry Page sixty-five SULLIVAN, ELINOR ANN THOMPSON, BARBARA MAY Middleboro Glen Ridge, N. J. History Psychology TITUS, LYDIA WOODRUFF TRACY, MARY SEYMOUR TURNBULL, PHYLLIS BURROWS New Rochelle, N. Y. Summit, N. J. Binghamton, N. Y. Psychology Mathematics Spanish Page sixty-six of 1947 = sane VAN DER VEER, VILELA, LUCIA JUNQUEIRA WEBER, DOROTHY CARTER EVELYN GASTON Sao Paulo, Brazil Waterville, Me. Somerville, N. J. English Art Biology Page sixty-seven The GEASS WILLIAMS, MARIE LAWSON WINNEG, SARETTA WOOD, CORRINNE SANFORD Newton Highlands Brockton (Mrs. Winston L. Wood) Music French Segreganset French Page sixty-eight WEBER, NANCY ELIZABETH WITAKER, NANCY Upper Darby, Pa. Auburndale Mathematics Psychology MORITZ, HENRIETTE Michigan City, Ind. Chemistry (absent) ZIEBARTH, GLORIA JEAN WOODLING, ELIZABETH DOWNS Carey, Ohio Wallingford, Conn. English Psychology Page siaty-nine ooking Back With te) ke 7 pdemeios © oe ee eo (i a pikes SS ae oP 2oes ee ee a | -“ SS SS a ee PD Aa Fea ee ee eee . : : + CLASSROOM On with the show! See the noble lion, the trained seal, the performing poodle, the jug- gler, the clown, the man on the flying trapeze. See them all strut and fret their respective hours. See these players for all their warmth and humor; but hear them also that their words may not be lost to a flash of memory but heard forever more as they go on, on with the show. 8:30 A. M., first bell, the show’s about to If only time could be suspended in A long line of ap- begin. this crowed five minutes. prentices, clowns, and mere lookers on pours out of the Chapel. Splitting into two main streams, the first finds place in Mary Lyon, The second is merely a detour from the main line, eager Science Building, Doll’s House. young hopefuls postponing the more official business of the day with a check on the mail. As the last bell, curtain time, is sounded this second line develops an erratic, jerky move- ment in the effort to join the first. Other doors open as late risers rush to their places, dressing enroute and harassed young clowns stuff cram notes into their pockets or clip a few sheets together in the last minute answer to the roll call. During intermissions, over a cigarette and a hand of bridge, the players hash over the day’s performances. Some complain that they are not accustomed to the whip, others suffer from juggling too many ideas. Some are not sure of their skill and idly dream of the ideal situations in which others such as the elephant, the tattooed lady and the two-headed woman find themselves when the test comes. On days when the show goes well, when performers and audience are in perfect accord, clowns wear their happiest faces and gazing up at the tight-rope walker skillfully maneuver- ing at frightening heights they forget their own clumsiness and share the joys of the few who really know the ropes. With paintbrush or pen, Freud or formaldehyde, the students deco- rate the circus. Rorschach ink blots puzzle the sideshow artists while surrealistic impressions of Jonathan Edwards lead the readers of the program on a merry, symbolistic chase. Page seventy-seven Too late to bed and too early to rise. You too can be the life of the party. Why Oh why did I ever leave Wyoming? Breakfast. 3 The Silent Prayer. Well, you've gotia bull sometime. estnimecnaipeemaete co ee Censured! Morning pick-me-up. A girl has to think of health, doesn’t she? Fun—if you’re over 21. The Missing Link. Completion and Absolution, 8 S Thenail - “ : Substitutions Morse, Gardner and Davis go- ; GE | ze 3 ' { G Ya iE a a 5 Neuer ing in the center of the ring for Benson, Shaw and Urner. It did not take long for our new Gym faculty to learn the ropes under Miss White’s tutelage and Miss Barry’s records. “Swing that bat and hit that ball,” so we tried anyway. From fall through spring we worked and we breathed athletics. Blinded seniors and tackling profs completed the hockey season in a desperate tie at the Nat Fletcher, head of hockey, chose a winning honorary team. While the hockey season closed Cush led the Wheaton Horsewomen to victory over Senior-Faculty hockey game. House in the Pines. First it was Kay Garriques and now it looks as if Bobbie Holden °49 will hold a four year tenacy on the Tennis Cup having defended her laurels successfully against Pat Silmour °§0 in the finals. Rexie managed to keep the tennis ladder straight. Liz Jevdet pushed up the basketballs and kept peace among the con- testing players. Bobbie Kahn struggled to get through the Bowling and Ping pong tournaments before the spring of °48. Wheaton and Them and Dance Group wit- nessed a splendid Modern Dance program executed by Jose Limon and Company. Later on Dance Group gave a fine performance in the spring. Country Dance Group was of- ficered by Marge Simons who also headed Dancing under A. A. They too performed be- fore Wheaton spectators on the Gymnasium arena. Gloria made Robin Sherwoods of some of us as we strove to get the arrow in the ever- changing red target rather than in our neigh- bors’ pantaloons. Outing Club with Brownie and Bev tramp- ed through the Blue Hills and went square- dancing in Boston. Dottie and Peg kept them in funds and up to date on Council affairs. Outers believed in seeing America first, but they saw a good deal of it on foot. Scat directed Baseball activities in the spring and climaxed the season with the Brawn versus Brain or Student-Faculty baseball game. Besides the fact that a certain student gets pitcher arm happy and tries to knock Dr. Meneely instead of striking him out, and be- sides the fact that Umpire Sprague likes them low, the game is up to National League stan- dards. SPORTS - ACTIVITIES “Hurry, hurry everybody for the greatest show on Building Shapes the world has ever known. See for yourself these slips of girls toting 200 pound bells.” At times this seems to be the ambition of our Trainer, Miss White, as she puts us through our paces of pushups, dives and jumps. Many of us, however, have been thankful for the exercise as we tried to rid ourselves of that “‘source theme spread” so often acquired at schools of higher learning. Besides required sports we had many choices of required Sophomore dance, required Freshman tennis and just plain required. Considering that the Seniors had no required gym they kept in shape very well. Fall found us falling all over the place chasing white balls o’er field and net, in vales and ponds. The Fresh donned their familiar pink and blue tights to make like butterflies in Plimpton while the Sophs found all their wind and more on the hockey field. The Juniors kept jolly as they played on all six tennis courts at once. When winter arrived we brought out our Flexible Flyers and coast- ed down the Dimple’s cheek. This was not enough exercise so we went out forTritons, Tritonettes, class basketball and badminton. Come spring we tried out for tennis, riding, and baseball while the Sophs speedballed down the field. Come summer, we went home to rest. Page eighty-two SPORTS -A. A. They snap the whip while we make the trip. Not quite so brutal but just as definite are the four cohorts Peg, Izzy, Betsy and Janie who contrive with Miss White to make our sedentary lives activated. They succeeded very well, we might add. ‘The lone resuscitator from all this hustle and bustle was Ginny Vogt, ever present with not “‘spirits” but oranges. Over cokes and smokes, A. A. discussed the activities of the Outing Club, Tritons, Tritonettes, ping-pong and interdorm Bowling Tourna- ments. Also under their close scrutiny came Dance Group and_ the Country Dance Group. They arranged, too, for Wheaton to be repre- sented in hockey playdays at Beaver Country Day and at Rhode Island State from which we returned undefeated. A playday at Wheaton in- volving several colleges was set in the month of March. Sports heads also contributed ideas for the activity list. Reports of their success were delivered at seasonal sports meetings on the refinish- ed Gym floor. Page eighty-four D. A. skyrocketed to the heights this year with one of the most skillful productions in its long and varied history. The praises heap- ed upon the Fall play Our Town cannot be too great coming from a vast audience of theatre- goers who seek pleasure at the ‘‘show of shows’. The meteor-like success of Our Town tends to cast a shadow on the many other contributions of D. A... Nativity Play at Christmas, May Day Festival in the Spring, and their part in the Freshman production which was arranged differently this year than it has been previous- ly. In connection with the Art Symposium in the Spring, they produced a one-act play on the arena type called Overtones which was a decided factor in the overwhelming success of the Symposium. Under the swift, sure hand of director Miss Jean McKee and the backstage crew of Miss Priscilla Okie, a play soon loses that mario- nette Punch and Judy quality and becomes a living, realistic performance. The performers lose those spasmodic, uncertain movements of the wooden manikins and the performance becomes that polished production which is the pride of D. A. With Dottie leading the troop this year, D. A. members, regardless of their part, whether it be long hours in the scene shop, on the stage, or in back of the stage, have been ultimately successful. As the performers are put through their paces, Wheaton audiences watch these shows within the Show sometimes with pathos, with laughter, with indignation or whatever the mood of the moment creates, but always with the appreciation of a fine performance. CGA Shirley Johnson, El- lie Sullivan, Ginny Hunt, Jean Schabacker CeCe High above the three rings of the Big Top where the lesser acts keep the audience amused and delighted, are the tight-ropes and trapezes of the C. G. A. aerialists. A hush falls over the audience and all eyes look up as the spotlight focuses on those stellar performers. Foremost is Ellie Sullivan, who maintains her serene dignity even in the most precarious situations. The first to arrive at the “Greatest Show on Earth,” (Freshmen) watch Ellie in awed admiration and wonder if any of them will ever reach that exalted position. Ellie shares her spotlight with a capable supporting cast. Applause should be accord- ed to Shirley, Schaby, Ginny and Scat. They in turn depended upon the cooperation of their assistants. This is the act which not only carries on the work of former aerialists, but each year adds daring in- novations. This year C. G. A., through the Co-ordinating Committee, managed a four-day vacation for us at Thanksgiving time. New smoking rules, that of allowing guests to smoke in dorm parlors and permitting smoking on Howard Street and in parked cars after 6:45 were also introduced by C. G. A. and accepted by the faculty and student body. These skillful aerialists have given a spectacular per- formance through 1946-47, keeping their equilibrium even on the highest and most difficult tight-rope, and have certainly set a high standard for future performers to follow. Page eighty-six C. A.- CANDLELIGHT Mingled with the clamour and excitement, the gruelling labor and feverish pace of circus life, each year Christian Association gives the performance an added touch of dignity and fellowship. With a shadowy symbolism that is barely discernible above days that are cram- med with trivialities and routine occupations, it gives these same activities the strength of purpose that lies in a spirit of fellowship in the vision of a common ideal. One autumn evening the whole community gathers for worship together. With a prayer the light of a single candle is passed from hand to hand until each one holds the spark from that same light. When the company file out into the night, darkness has softened the day- time glare so that each one can glimpse a star answering her own light as the voices of friends rise as one in the stillness. The circus parade becomes a shadow intensi- fying the distance from each flickering candle to the answering stars above. The line moves slowly to the edge of Peacock Pond. But in this light the offering is not to the vain world of the peacock; instead for a moment the shores could be that of a great sea before which only thoughts of faith and love can find reality. In this humble attitude some step forward to Jet their lights float out upon the water. CA Till Snelling, Sue Lewes, Ellie South- wick, Betsy Bird Page eighty-seven ROMANCE LANGUAGES CLUB Phyl Turnbull Jan Doerr, Pat Spencer, Priscilla Dattman 5) PSYCHE Betty Green, Gloria Ziebarth, Mitzi Mitchell Page eighty-eight CHOIR Helen Bolton, Audrey Farrow, Pat Fuller, Barbara Thompson, Jerry Simons CLASSICS CLUB Til Snelling PSYCHOLOGY CLUB Sue Williams, Shirley John- son, Stan Kreh, Ginny Hunt i Lithia Cintanin doit Giles s Bi: ee ae We _ oon oe ART CLUB Clio Colivas, Jean Haller IRC Lois Renouf, Jan Maul, Phyl Maynard, Nat Fletcher, Jo Dingwell Page eighty-nine bowing peettel SE rasm at b1e8 NEWS Peggy Duffy, Mary Renwick, Phyl Maynard, Barbara Lynn, Bobbie Ascn “Programs, programs, you can’t enjoy the show without a program.” And here is your program, THE” WHEATON | NEWS. “Its pages feature main attractions under the can- vas, sidelights on the sideshows, and snaps and caricatures of the stars as they perform their Page ninety “daily daring deeds.” Not only does The News keep you posted on what is what in the three rings but it also brings you up to date on the highlights of other shows on the national and international scenes. ‘Don’t forget to get your program.” RUSHLIGHT With a roll of drums and a blare of trumpets the floodlights focus their rays on the center ring. On comes Rushlight with trainer Roz Roth putting her talented performers through their paces. Nothing short of perfection is expected from these gifted creatures so their act is put on only four times a year. And what long arduous hours are necessary to pro- duce the polished rhythm and skill that finally meets the delighted eye of the audience. Bright balls of scintillating wit and luminous beauty are lightly tossed by some of the stars, while others move through their appointed task with the assurance of a savant. ‘Tinsel and canvas make the blended fabric of light and serious writing of which Rushlight is composed. In applauding the creative genius of these actors, we must not forget to give a full measure of credit to those behind the scenes who staged a performance to hold our interest with its per- fect timing and brilliant execution. PRESS BOARD Colorful flyers and handbills reach the home town newspapers, fanning out North, East, South and West from Norton, home of the Big Top. Indefatigable press agents, Mrs. Sprague, Helen Caracuzzo, and other members of their staff, feed to the local press of cities and towns a constant stream of publicity about the local talent who have made good as stars in Wheaton’s great performance. With such high-pressure advertising of its main attrac- tions, Wheaton can easily maintain its position RUSHLIGHT Robbie Gash, Rozy Roth, Barbara Rex, Mike Maxwell among its lesser rivals of ‘The Greatest Show on Earth.” fRESS BOARD Carol Stein- bring, Peggy Duffy, Helen Caracuzzo, Nancy Cooke, Joy Merritt, Mary Renwick Page ninety-one NIKE EDITORIAL STAFF One by one the acts have been presented in their turn dazzling the eyes of the spectators and bringing forth great ohs and ahs from an admiring crowd. It is a little sad to think that this year’s show is soon coming to an end, but hold on to your seats, ladies and gentlemen. Here comes the big finale—Nike, the act that summarizes all preceding performances—a grand review of what has been. Watch as they pass before you—the clowns that made you laugh, aerialists that thrilled you with their daring feats, the side- shows that amazed you with the marvels of nature, skilled bareback riders, and the performing animals with their clever tricks. Last but not least, the stars of °47 who have climaxed four years of hard work with this year’s brilliant performance. Look well at their faces as they pass, ladies and gentlemen, and wish them success as they leave this show for the bigger one that awaits them beyond Wheaton Big Top. Amelie Burgunder Bonny Rankin Page ninety-two “Grab your coat and get your hat, leave your troubles on the doorstep, just direct your feet to the sunny side of the street”’ is not the theme song of the 1947 Nike staff! Amelie left us for Bernei and a_rose-covered cottage, Betsy and Carol left us for Europe Jan Maul and intellectualism, and we, Mike, Bonny. Cush, Pat, Ceci, Izzy, Jan and Trudy, were left holding the proverbial bag. We had the good advice and sympathetic understanding of Miss Work to help us unravel the maze. Without her Nike would have remained a dream and would never have been an actuality. Clever Amelie left us with a terrific dummy .. .terrific with unique and original ideas, and terrific in scope (as Cush will testify after hav- ing tried to collect a gross of pictures). A dummy, to the assembled group, came to represent some kind of Greek. And none of us had a Greek dictionary. ‘Then we tackled the Engraver’s order blanks and tried to decipher their jargon. Life became a hodge podge of unintelligible terms that loomed before our frustrated minds with the black threat of doom. All was chaos! And we couldn’t believe it because Amelie had said the whole thing would be so easy. Oh, well, we thought, to work. And work we have, ever since. All this time our team of Business and Advertising, Trudy and Jan, were organized and pro- ceeding with unimaginative efficiency. They made the cash roll in in a way that would be advantageous to any organization, which, luckily, was ours. For the 1947 Nike is one of the most expensive ever tried at Wheaton. Trudy and Jan are gems of financial wizardry and should be recommended to the Treasury Department to balance the budget. The rest of the “artists” as we hasten to label ourselves to explain fits of temperment and other unre- liable qualities, fretted, fumed and foul- ed up many, many deals before we final- Trudy Cambell ly saw the promise of Nike as an actu- ality instead of a misty illusion in Miss Banoy’s (Mrs. Burgunder) mind. So here it is. Ceci Kuehnle a Mike Maxwell Mary Cushing Izzy Lindsey Page ninety-three SOCIAL There go the men with their buckets of paste, slapping up the gay posters which lean idly on walls and in windows in Marty’s, Pratt’s and the Bookstore. The lazy progress of the men is a tantalizing dance charged with the excitement of the fun which will follow them. We run behind to read their gaudy signs. Each one is turned staring expectantly ahead, its message screaming in the morning quiet or lost in the din between classes. Soon the big parade will pass this way. Here comes the parade. The riding team is in the lead proudly displaying their acrobatic skill, As they pass the Dimple we see a balancing act. There’s an elephant standing LIFE on another elephant, standing on another ele- -phant who isn’t there at all. Seems we just missed the announcement of the senior class officers. But lo, ahead some of their stately numbers are backing down the library steps on their hands and knees, scrub brushes in hand to honor the Queen of the May. Here come several floats full of campus celebrities taking bows, the casts from the dramatic productions, Vaudeville; Mummers Procession straggles on behind, forever in memory will they sing “Hail to Brittania,” and ‘'God save the Com- monwealth of Massachusetts.” Everybody’s mumbling something about a place called Yellow Parlor, maybe we can find a cup of coffee and a place to sit down if we can just get inside that big tent. People keep piling out. They can’t all be coming out of that same little door, it’s impossible. Look, there’s D. A. and A. A. and C. A., News, Rushlight and Nike. ‘There’s F. C., R. C., G. MemmorelereG.. GEC. A. Gand DG, There’s a notice: “Outing Club in Cage.” I can’t face this mob any longer. Let’s try the path to the lift. Strange, we’re in a dark garden. From the veranda above, soft lights, music, find us. See silhouetted against the rail lovely long dresses, dark tuxes, cigarettes gesturing between them. I remember, it ends in a parade to information at 1:30 A. M. DORM Take part of the sideshow and throw it in the animal act and there you have a candid shot of dormitory life and those who make it up. The tall and the short, those who are on a diet and those who are not. Yet there is some basic unity, something that makes us respond to the proverbial call, ““Who’s the telephone for?”, and the more blatant yell, “Freshman, answer -the phone!” The clump, clump of eager feet dashing down the hall to see who the Saturday night date is going to be. Study is something that is ignored until the chapel tolls up eleven or twelve P. M. except for those persistent bores who are heard echo- ing down the hall, “Quiet!” But at this hour begins the trek to the smoking room, to be enveloped in the smoke and surrounded in the chatter that may continue until any hour. .. perhaps all night. The smoker, the center of dormitory life, the scene of many a tense grand slam or of terror as our friend, the centi- pede, starts paying a social call. Ah, that forbidden aroma of coffee, that filters through the hall, a rather mutilated vic turning out Rachmaninoff or Hot Lips Page, isn’t this what we'll remember when we tack the program on our bulletin board? LIFE “He was sensational!”, echoes the cooing voice down the corridor. Mixed with Bunny Berigan’s I Can’t Get’ Started With You, we have the perfect setting for an all-night stand on the male problem that keeps us on a con- stant Merry-go-round. Grab for the rings, girls! Who’s the lucky one? Under the pro- tective Big Top of old mother dormitory, we let down our long, golden hair, crump on a friendly floor and decide what the next move will be in this sideshow of life. VOD A circus occasionally becomes merely an excuse for its sideshows, and Vodvil was one of the best sideshows Wheaton had to offer this year. The big placard read, ‘So Goes The Nation” and so went Wheaton by the droves for laughs, songs, and some of the best dialogue heard on the Vodvil stage in years. This year Vodvil had a “what would happen if. . .” theme, explicitly what would happen if Wheaton became the training ground for Senators and Washington bureaucrats. Patsy Gumble handled the usual director’s dilemma easily and brought forth a picture of classroom chaos and campus ro- mance. VIL Vodvil brought in many innovations this year, one of the biggest and most successful was the substitution of modern dancing for the usual Ra Ra Boom T-A style. Them Sarris and Ceci Kuehnle were in charge of the dancing and their Marty’s Scene was one of the most colorful in the show. Also an innovation to any show would be statues who could “adjust” themselves in accordance with a Danny Kayish Dean’s exhortation. The biggest applause of all goes to Miss Clewes, who, as the much misunderstood Minerva Minestrone, immortalized Vodvil, the Gym Department and herself. SS HOOP ROLLING FOUNDERS DAY GRADUATION TRADITIONS Traditions are the bright-colored lights that dot the fairway of our Big Show. Each one has a different hue and a different meaning spot- lighted in the panoramic scene. Processionals to the Chapel usher in the year in celebration of Founder’s Day. Rows of bobbing heads and blocks of color distinguish the classes as they march around the Dimple. With the frosty windowpanes and the snow-piled walks of winter and the Christmas season, Wheaton revelers don Medieval costumes and cavort through the Christmas Banquet. In a more serious vein, two seniors are chosen by their classmates to represent Joseph and Mary. These girls personify all the fine qualities that go to make the ideal performer. When the violets peek through the frost-hard ground and sophomore sisters hang May baskets on their senior sister’s door, May Day Festival lights up the winter-worn spirits. A sopho- more Queen, chosen for her beauty, parades with her court through the Dimple. In June with graduation there are many traditions that help to endear the memories of the Big Show in the hearts of the seniors. To Lala, Queen of them all! May Day frolicers cavort in the Dimple while the “maddening crowd” peeps in on Wheaton’s sideshow of beauty, the Vir- tues, and May Day dancers. Round and round the May Pole they go. . .attached to the multi-colored streamers of fortune. Sturdy archers aim for the bull’s eye while the Jester whispers funnies into the receptive ears of the players, and cartwheels from one to another flaunting his quips at the wide-eyed spectators. . . The Biggest Show On Earth! Page one hundred one RINGS WHEATON SSS 1G = SSS So SE Eres SSS LL SS BSS SSS ps SA NSS SSS é ft i 4 For us there is the pause of moments seen In unsuspended time, Remembered by Small incidents which crowd what has been A lifetime With the question always why Some things remain and others, Instantly Are perished, Lying threadbare by the way, We cannot know that even they will be Tomorrow’s ghosts which lie so still today. Not gods but minutes are our lords, Which awe Us, and like monarchs hold themselves aloof That men may not escape their iron law Nor ever rise beyond the rusting roof. ip a HUUUCOOGUAEROOUUUUETEDEREOASOD DADE UEECUN EOCENE SOE SEOOOR EE OOCSEROCTED DOOR ERCCSCNCCCHEUCEOCEUDOUERCCSEOREROSRHEROEECEOEOSEQRSERCREEOEORL VUCUCURCUUCEGUEOCOOUCUCUUCUTUCEUSOURUUEUSUOEODSTOOOUUOURUDOCOUOD USOC ORONO OOS COMPLIMENTS Ole Wale PARENTS OF WHEATON WOUCUUCUUUCCCCCOC COED OCECUECOCUO ECC NESE EE CECE CCE E COCO T CDEC CCC ATAU PEE CUMDOSCUUOORCCAUUUAAOUOSONECUUEOCUCHESOOUCOOCOUOOOOASUUUENDOLONSODSOODOOUAESUOOUANLSUAUEAAOAONOEOOSEENENESNENE, Page one hundred seven Mansfield Record Shop COMPLIMENTS OF Records - Sheet Music THE MANSFIELD ‘. Popular - Classic LUMBER CO. Also Radios - Phonographs N. Main St. Tel. 173 PCLCKCECCCOERERED ASSOC RROCR OER RO REDCAR EERO OOD CECRERREC RREGOP EGRSERC CORE O CCRC EERE EAE O ESCO RH CE EERE CRUSOE TUPCOUONSUENTCUUEEDOQUUECCCSESESSC ELON EEOCCERESSENELCCOECCSH GOURD UTCCU REED AO RTOCESOSR CORES ERROR RRECERS UNITED CHOCOLATE REFINERS = = TUCUCHONCQCOUNEEOESUEEUUGOOSSQUCOUEURODOUCHOSESOODSUQUADUSSOSOCUESOUACCQUDUREUEOUSUAOCGUCQCRACCCCQUSOUUUSOCUOUCTOORGURUCRUADCUCUCOCSUCCSESCUOTURCCRONDOCCESURSU DEUCE ODES OSE OCCUONOUEECCESEOSECRUCSCLGUOUUREREROE RE UGG VUDVEEUOAOOULEREEREEEEUEGHOOUSUUEUEEESUSCUSCOUDOOUAOAOOUUCOOSUEURCUOUSUSCOOUCUUOUUOUOOSUGUKUCUCUCECUUUSUSCOSUAS OO OO0UDOUOEECEOUCOCUUUOUOOOCOOEEEOLEUEOUCUCOUARSEOEEEOULECUCUUCOOCUUOCEOREEUUCOCECUUMEOOSOOEREEREEOSEEES COMPLIMENTS OF A FRIEND GeeveneuceveneuceueeeeeeeeeeueecessusueungeueeeeeeeeeeUeeUOUeeUSUUOUeOUUCUCeeeeeeeCUeeUUeCeeOEUCeeeeeUeCUeeCeOeUCCCCCOOENCOCCOOCOOECOOCUOAOESUCSEOOUAECUCCCOOORULEOOAEUCUCEOUASCUOUECUAEULURELARELUOHCOSERECOCEOOUELTE MCC COOO UOC ULC C COC CCC OU OU UU ORO ROU UUUUU UCU UUUL LULL UULG LLL e ill ttle POUORCOOUEUPOC CED ERE ECC EOS EEE OCUR EEE E GEE EECCA OPER SEER AGERE CECE E PEER A OSCE ECC O REDS DESO ECR SOS ERED OSE ORES Parker Clothing Co. COMPLIMENTS OF Featuring: ‘4 Carol King Dresses ae Anne Wellesley and Sherri Juniors 210 N. Main St. Tel. 84 3: 160 N. Main St., Mansfield fi Tel. 475 TTTITITITT TTL TTL TTP TUUPC CAO P EU OCUEEOCCUCCORERDCO SCRE RUSECEEOSEOEEEEOOCCCUSEEEUEREOOCSOSSOPPEREERERGCUDOCCRERSESCECRESESOOERREL Page one hundred eight CHE ASS Seed eae DT TeLOuN a To the MCMXLVII MCMXLVIII WOMEN OF WHEATON We EXTEND our congrat- ulations on completion of a successful year. Schooled in beautiful surround- Ings; inspired by a splendid staff; the women of WHEATON take their places as leaders in their home communities. We ARE PRIVILEGED to Serve you with your class rings so proudly worn in the glory of an old tra- dition. ae) e3| =e TR © Zi Ee Q on er 4 Z q2 (ep ee) o op COMMENCEMENT ANNOUNCEMENTS L. G Balfour Company ATTLEBORO, MASSACHUSETTS Clarence B. Goodwin REPRESENTATIVE MCMXLVII MCMXLVIII ENS he Oebs Rim) LeAL Laren ys Page one hundred nine For the necessities of college life Visit THE WHEATON COLLEGE BOOKSTORE If you don’t see it - Ask for it. It will be under the counter. We appreciate your patronage. (TONOGUUREOUOUADOOUADOUUUESHOOUGUECODOOUSEUOROUODUQUCECEOGEUOCUAUOEOECHOOOUEOOUGECOUGUO OCEANS COOUOOOUUEORUDUGOOSUSULOOSUCEOOOOUOOEDODEOEOUUOOOIOOOOGUOUCSEOUUUCCURUCUOUUOUSUUNOLOUUEOOLSUOCLEOSCONONECUOOOUCEOOEE SOOTY COPEPEDOOOUEDEQNEROUUDERSUEQGDOUGROGUCUOGCCOOCUOCCCCCCCUCQODREOUCGCOGUCUEOGUCCCEEOOCUUEOOLCUORCDECHOOCCQUCRUOGUOUOSOUCROOOOSTDUTUOUDELOUERDSORSPOCOOUEOSRUERUOEOOCOLLDODSOPUUCODOOCCORCEELOOONOOROCOORSSCOTEO RODE EEO DOERDE POE@ DINER Taunton Ave., Norton, Mass. (PEDCLEEDOEORSUDECROUSCCUEECSSOCUNSORUEOSOEEOOSERREOSUAERSOLERSOEORSODOGEEAUGSOOUCEOACORNOUEASEOSEEOSAOECCOOTOOSEEROOCEEROOCEEOSEROUOCERDOSUEDOPODERESOUSOOOAEROOUAESSOURESDODEDSODDRRSDEERESRNASODODDSRODOEERO GREED NEAL Page one hundred ten DPEUTUOVCNUCUCEOEOUEECUCOUCECOUOTONECUOUCHODOOAUOCUCTOCUCCSOUDOOTOCOCUEUGUQUUUCSECCNCQUOCUORDQCDCCOEONGQUUURCCERNCCOUOCOOOGUSCUCCCUSOSOOOSCERQUTODONODCCECRCORDOGHUCUOCCOQGCUOURUCUUCCONCRCRUCGCCCCORUTOSSESSCTCRT OT ES BEST WISHES FROM CLASS OF 1947 upaASUASSUAUOQNUSNOGUSAUCOESADSESSUDSOUUSCUSOOOAUFOUSONOERDOQNCUULONORNCRONCCOSUGSLDNGCOUEUAUGGUGARCRCLOENauceLoODeCeUeneenaNeOReEONaUUeCresesenegReaeegususuuuanuaarsuveucascgucgurencotenseusencancasnassscqaty Page one hundred eleven IT’S COMMENCEMENT DAY FOR YOUR FIGURE, TOO! (And that’s where “DARLEEN” Elastic comes in) Making your mark in the world calls for a combination of many things —and a shapely figure, for one, was never known to impede the fairer sex in their manifold quests. (Ed. note: with accent on the man!) That’s why you want to be seriously careful about the foundation garment you choose. Make certain you’ve selected the right type for your kind of figure —that the elastic in it is lively enough, yet light enough to take care of those excess inches without sacrificing a fraction of your freedom. Ordinary girdles may not give you all that, but fortunately, girdles for the younger figure have been graduated from the ordinary class these days with DARLEEN Elastic. DARLEEN differs from ordinary kinds of elastic in the way it’s processed and tested —a through and through method that makes for greater resilience, durability, and empowered lightness. And that in turn makes for foundations that mould the figure into smooth, fluid, fashionable lines without restricting natural body freedom. So ask for girdles made with DARLEEN Elastic at better stores everywhere —and good fortune will shape your future! ) Darleer REG, U.S. PAT. OFF, ELASTIC “BES PO BY CANY abs EL DARLINGTON FABRICS CORP., EMPIRE STATE BLDG., NEW YORK 1,N. Y. Page one hundred twelve PUUUUEUEUUERNUECOCEASCUEROSESHU NSCOR SOSCORATECRUNUSER ESOC OSES EEN SC SPE EAESOOEAOE CEST ORE A SCE EETCSE CSC AS ERAN UC ESA SCE RUST OER SUESERU SES ES ORSESOEES COC TAT CESS TCOS RAED ERENT EES S SOC EETECEORSALE REET ER EETECSCU ESSE RUELEETESES SHOWER CURTAINS TARPAULINS CANVAS GOODS @ Canvas Specialties fabricated to any specifacation WEBB MANUFACTURING COMPANY 4th and Cambria Sts. Philadelphia 33, Pa. S spuneuvunneneuevensusuouseuenveuaesensnensensunnuanscuncenascansucncnnenenueseasuacseeauaeueneueagencusnseneeusnesuseseuegsvavenuanegeusngenenenecanseneneeesevengeseneneeueseuauaenenssersensegnarennennasiyenss Page one hundred thirteen Steel Drums for All Purposes FETTER STEEL BARREL CORP. BUFFALO, NEW YORK TTeUOUeeUOECeDOCOeDESeCeOOUCHUCEOOEOUOSUCERSUSUEGUSESOSOUSOSCOUREERUOUUCEQUQUCQUCUUSUOSCOOUCCQCEOOUSUOCEOOUSEOUCDOOOUSEROUCHEOOOEOOUUEOSTOOESOORCEDSUSOOCEDEROUOOUSELQSOUECUESUESUOOEOESUOOUEUOOEOSROCEUOSERO EERO ELA) NUTITEITTTTTITET Te JOHN C. PAIGE COMPANY INSURANCE As pioneers in the development of Medical Reimbursement Insurance for Private Schools, Colleges, and Camps, we have been happy to serve your : insurance needs. : 40 Broad Street E BOSTON : New York Portland Los Angeles : A FRIEND OF WHEATON COVEOORTORRUDT RUDD RO RATA STURT ATROH DUD U DCEO KUTT DRAKE RST E HERR Gee eee UPOSUAPRCRER OREO R eee in Quality and Flavor .. FRUITS VEGETABLES RELISHES SoS Page one hundred fourteen DUCDOUCEDEEUEEODEOCOCUOOSEOOUROUCULOUDOCEODDOEOCODDOLOOUOTCOUOEIUOOOCUENOCOODUUCOOODCCHOUGEEOOCGUOUEDUCCEONT 9.2 eRCONDTECCER pons APOCOCPED OOO U CONOPEEESCCOTESUECNDETTOCCCOUCOCCCORTHEEORUHECUUTLOETEIOFOERHONERE GEO BEST WISHES FROM CLASS OF 1948 : eT SeUUEA TRA TAUANAUISURUANASSECHNASANUSUUZOSAURILUCSOUUKILEAAC1UIICCRSRANUSIULDOAICHVSAUALUTANECCULRISUETURCUSCUCADSRCLCUOAATANACLECSAULSAUSUSCLASALULCLOOEASALSINOSASARAUUNALLSENOSCISCORUSAUEAUALEORRAGRELPLASOR cone Page one hundred fifteen RUPUCCPRECCECPECOCR TERR EEROCCET APE ATED TOLOP PRCT CEP PEER EPEC EPEC EEC R PEPE ER EERE ERREE ERE R CORP EERE REO mUPPEIUIIIIIIII III CORCCURSREUOTOCECESORECCEE OEE cerecesseane The Northwestern Compliments 2: : a : Mutual Life Ins. Co. : of a Friend ii Of Milwaukee, Wis. ae I’, Warner Heinekamp San Juan ae General Agent : Puerto Rico = 617 Broad Street ae National Bank Building z Trenton 8 New Jersey GUCUUUUEUDURDEDESODOOSPEOOEOECCOSSCOOOPOEENTOREEREECOSSRSROUETOGKOCCEECCPOUSRENCCUOEOTEREERECCOON ESTO DEE EE VTCCCCCUOOOC CCPC NOOO AOU AUECECACC PED CEC UPCCO SOOT O CRU OR EEO CHEOCOCCEED ORCS NA ENECREEADONORSACOSORREDEOSEOOORE Edward A. Brodeux Swanson Baking Co. Attorney and Counsellor : Bakers of Town Talk Bread ee Es and Town Talk Cake Suite 429 Chapin Building aE Worcester 8 Massachusetts : : FITCHBURG, MASS. DOCOUOOOUUUO Ces COUOUOOCUOCUO CC UOUO OOOO UCC CUUUC COO UOO OC UUOUCCUUCOUUOOCOUOUOUUUOOCUUUCOOUUOO OCU PUPPOP CPUC UP ECEEUPEP EP CEESEPUE ODEO EOE O UCT O RET ESSE AEST T ORD T TOT T EET SEO PTE SES EO ROO PERO PEROT E EERE EEA aY Share Through C.A.R.E. =: Hamitances to Eas Ine? THE GANDYsa Bor For $10 you can feed a family of 4 for 2 weeks Write today to LARCHMONT, NEW YORK G - AIRE 50 Broad St. New York 4, N. Y. : Continued Life on This Planet — : Depends on : CONSERVATION of our Natural Resources and their use i on a Sustained-Yield Basis Page one hundred sixteen OUUUU CSR UOOOOUUUUU CUD RUROOSUOUOEOEER UU EU UU UORUORUROEROROEUR UU UUOOUROOOEUUOCEUUU UOTE OOUUOUIDUDEU TRUCE SOUS OUOOSOIOUEEOEECU COU SRUCOIUUOSOEIEIIOSIIC ETUDES OTIEOE EES OS TERT ROeUER Oe Bayard Tuckerman, Jr. Robert J. Dunkle, Jr. Arthur J. Anderson Robert P. Forrest Julius F. Haller Here’s your introduction to friendly, efficient service. Do you realize how much personal property you have at school— clothing, furs, jewelry, personal belongings? Are these items insured against the usual hazards which exist in everyday life? If not, are you interested in procuring insurance protection? We would be pleased to give information and quote rates on any problem which you have pertaining to insurance. OBRION, RUSSEL CO. Insurance of Every Description 108 Water St., Boston 6 111 Broadway, New York Tel. Lafayette 5700 Tel. Barclay 7-5540 Pare | Page one hundred seventeen POCUP EPP EPERERCSCE COCR AERP ESPON SERA E PEROT CCC C PEPE SEPP E ESCO RECEP CACC R PREPS EERO PEERS REECE PORE CPAP OTA E CRRA CRP PR EEC OPER C CEO E OCR ACCC CERT E RHEE GREP EEE ER EER EOERCC ERCP P ECR E POSE RECO SRERS SESE CATERER EERE OREO ER Best Wishes From Mother Wheaton 1911 to Daughter Wheaton 1949 TUCCOOEODUUOEONOUEOOUOOUEOOCOOSCUEERUOEOSUCUEEORUUOOEOOUCRUOCOUAUECOEEOSUUSOUOOORDOCOCDESOESECOCESSOOUOCCOOOUEOSEEOREADEDADEOUSUSCQUOCC COON GODEEROCRSOESOLEOCORSERRUROSEORDEUOUEOSEDODEUSORSUEESOUESESEODOOENOOREDETT DEPUOD ACTER PUP CEPR EERE PE EEO COCO U CERO CECE COOPER EERE ROCCE CCAP OREO R RE OPPO PEPER SSCS EAE E SCORE ESPACE ARPECOP ROT E EERE ORCC CEP C PROUD CERT PREP OPER TORO E EMRE EERE AEP C CORRE ROCCO ETCH PERE O ROCCE REECE) THE PIPE MACHINERY COMPANY Plain and Threaded Plug and Ring Gages Precision Tools’ Pipe Finishing Equipment CLEVELAND, OHIO POPUP PCAC EPEC CEE C OPEC P EPEAT EPEC E CCAP POPPE EPPO POPP OPERATES PONTO P OOTP O ECT P PEPE E PRPC HORE RE OE EOP OP ECE ED COOPER SO CER OU OUERCOSERCRUO DOPOD ECROSEODONOSREDCCUECCSUREREOCESROSONR OR OTL UEP rere r Coe Pe ner UC Onn Oenruranunrnirneriririicverev iii itiircririiiivilieiiiiiiiiiitieiieii tiie Sales Service : Phone 119 : : COMPLIMENTS Norton Center Garage catia J. B. Scott, Prop. zi NORTON, MASS. a0 Mass. Official Inspection Station 1566 Parts - Repairs - Accessories WHEATON IN N Storage 7 PECCCUCCOCU NEO EOORECPAEEOCUAC DUCE EC ELEOEESOSO ESOP EERE EERE ECOECCCPSS CECE SEE E EEE E COS SPEC COCO TEER ERED, VERE PED OEU CPU E CCE EC PEC E PEPE CCE CCCP CS CCE PEO P ESTOS ECP E COTO EEOC POR EO SHPO OPES PEN ECOEOREOOEC EER EEREESEOSE ETT CEPDSUCCCECEUREEE REED EERE EES ECCCOCC CREE CECE EER OREOEE CREE OEE EE SEHR ER EE ER POEM REET E ERECT ERS U SERED SUCCOCCCUUOTCOUCU ECC EEP ECU OCCCUCU UTE CUCOUCEECEUER SCOOT ETCOECECCRUECRUCE EERE ERCCECOCEC CROC CCOCE OCU E EERE ER WHEATON INN —=—s«SULLY“S._ STORE BEAUTY SHOP): NORTON, MASS. Marjorie Wallent NORTON, MASS. PUCCECCCCC CCPC CUP EC CUO C OCU E UTEP ECC EC ADEE ES EE EP EPEC OCP S POC U TEPC ECACC OOP COC PEEP EP TEREST CUCVCUUCPOEECEECOUERCEOEO CONGO EDI EDIUPPREO OOS EET OSS S Pete iii ieeetirii iii iirisi ii iii iii i titi titi t) Page one hundred eighteen ee a Te CT PE TTECTaTOLCTaGeTTTTedereuivaeeTsvaeuvavaTitvtvanaxxsvaru1sTOIVN(XA0IXSUULU00C3A0 (CAS 0C0CUACUUC(KOEUSUESCUUCALADINGSHVLASECUEUSBNLES SRCUSIZESTESARECLINSRAUOUALECLNECDOALANEDS UST BEST WISHES FROM CLASS OF 1949 x susnvuaunansuenuseounvuuensseasuanncusnseneesseesauevucesusenstasenscusseeansavsansgesuenoceesuesnssuernsiueauengesnscagueuasecusensyenuacensensctevsueaucsausazuysaresguangqutoaesuiasnasayetsuasiaziggneneysine Page one hundred nineteen UEREREEOPRSUSL COOLIO EUOrie reeset ecnesti suse ir reesecercueiieeneririeiereeieitiecei eit tesee cei ieeieretcereririsce sien irieeetieiereiieeiitieeseeceieitrieieierse sete teeeeeeninieiiiteiisi reeset ets ecirese ieee een ODAMS DYE HOUSE, INC. M. 0. DRISCOLL, Treas. FANCY DYER AND CLEANSER Plant: 94 Tremont St., Phone 2427 Taunton, Mass. FUR STORAGE 14 Weir St., Phone 647 Taunton, Mass. 10 So. Main St., Phone 1781 Attleboro, Mass. WUCUOGUUSO RSA UOURGOU CCU RSOUCCUECCE RCE PCC UOTE OSE REU COCO CSUCUOUESEO UCP OCU OSU CECE COC HOO E CUE ESTERSE EOC E COE SCS ECU COTE OOP ECT COCA SOE ESE ROO E ECP ORE ROUSE COT ECCE EAT ECOL OSTEO EOO EOE E OSE ORCS CEA SORERAEOOEEENEEONEESEDONESONT COMPLIMENTS OF THE Central Radio Stores :: 4 Broadway Taunton, Mass. TAUNTON INN Radios - Records Phonographs : 33 Summer St. Taunton, Mass. WESCUCUONEUEOUEOCCCCCCOCURORESREOECAOEDEE EP OCAS CREED EREEAOSS CEES EPEC CAECCHT AGH CL NCPR PERE UEC EOE SESE EERE LAC a ML Return e Furniture for Modern Homes : LEONARDS Floor Covering Specialists For Over 60 Years Manufacturers of Highest Quality : : Bakery Products - Candy Bostock Furniture Co. :: ree aut 10-12 Trescott St., Taunton, Mass. Restaurant and Luncheonette Widely Known for “YOUR STORE” Unusually Good Food 35 Main St. Taunton, Mass. TO OC On OOOO OOOO OO CC OOO U COO OC COCO UUUOU UCU OOGUOUORUUUOUOUUUUUGLL COOCO COCO CO OCCUR OCU OO OCCT TTT TT Ty} DOCUCUCCCOOUCUCCUDOOUEUDEOECORO ECU LOUE SPE CU OCU EPOCEST AG ACP ECE RUE E CUE OCOEEOCOCOSERUERUEOURERSERUCCEOROEOSSSE RAE AU EOE OA SOS OU ARE RU DATA HAO E OU OEE GU UAU EOE OU ESTOS USESE ROE OETOCEROROERUESUEOTOP EEOC ESURO EOE COE ONE ODEO EEE EY PIERCE HARDWARE CO. TAUNTON, MASS. UECEUECSUSCCECUCNT NPE UEUEEUSEEEE ETE TOCVCCU CAPE CO CANO CU CUCU NCCU PERE CONDE ECUOEOEOU SAPO OA SPO ES EPO EU OO EO RCPS EEO EO ESAS) OSREOERO EES EOEOEOESUTORCESECCCOPEOEOCCOAURTAPEOEVOEOUREEOEACOEEERUSERVAEOEEODOOOSUOOESER EAT Page one hundred twenty UCOCRERESEDOGCUADEEADEUET ACEO PERCE ROCCHEOCOCOUU EAC EOORRPECOUREDEORESE EERE C CURE LOU EERE ECOGHDEO ROSES EO ER EOD ERORORERCOCCCECRE LCE UU CS ROR SOLER ORD TRO CR ONDER TORESSHRHCEE RSP ER COKER TODO US CR OS EESCHON AR EONOR OC EOCESOROSUS EOE N ST = = COMPLIMENTS OF MANSFIELD BLEACHERY SPOOOUADUDEOQUECEAUDOCODOREECOEEROESECCSCC NCCES E USO D GSR CC RAO G HCC R CPE E CEE CS CCEA SECS SCOUT EEC E OCC E EGE ES SACRO APES OCSS ESO EUROLS GCS CRO NOSE U DADC SSPOREERUUECCCSUS EEE O UES R ESE OD SSDS OCS UC SESS CESSES OCR OSS UO NCCH EDS TOEDOS ERE L TOOEEDEADCREPEG EEO EO SERRE ERE E CROC ORT E RCAC R EC CR EEE RA CROCE PRO K CERRO EEK R ERASE RPERE PERE CCR ER ECA T ERROR EERE ORES ERROR CRETE CER E REG ERE RCC E URE CO COTO C HACE CRORE CCRC UEC CH EERE E SPOR ERS E CCC OH TERE SCRE ECR RO CREEK ECHR CRETE ORS EOE COMPLIMENTS OF DEFIANCE MFG. CO. PTT COPOCCS POPPED CSP OPES PPC E CORP PEED E OUP P EPO P PEEP PEO PPAR PEPE P EASE OOO PUPPET COUT POC TEPPER CPOE PCED CEOS TEEPE REO ES CPE DEES SERED O PTE M OP OPP P REECE P PESO COMPLIMENTS OF ©: Jennings Linen Co. DANA‘S Everything to Furnish Your Room zi 76 Essex Street 85-87 Main St. Taunton BOSTON, MASS. TUPMNCRCOUO DON OPCOPP ES UCR DOES UP ER POPUP ER EOS EO ROESOR ESS OO OED A DEEDES OC POSER EEE O COPPER OPER CCR E POR CC CPE EE © CEU RS EERE ERE COCP EP ER UCDO UR OC TEPC USEPA SSAC COUPEE EPEC OPTS E OPN O REC H EOC T PEPER POCO SCRE ORDERED ECE Quality and Service Wagner's Flower Shop | WEBER FARM Bonded Member F. T. D. North Attleboro, Mass. 9 Phone 729-W Res. 729-J Telephone 2280 23 Bank St. Attleboro, Mass. TOPEROOO HPO O RDFA DOOD N EOC OS ODOR EAU ORO CO UCDO SE OD HEED EOD ONDE EEA DCD URGCCOURH EEO UD OOOO OREN CST OD ESOL ERODE DE VOCEUSCOOCUCDOCSUDULCLESUNSADOROONATOOUDTL COON TOONS OACCOET OPER DOES DOOTREEOGEODROQELODREEOQEREESOODSSONNIE GUDDPDEACODPUUEDOORUEPOUCREROUROR CERO NCC OR CORO D ECOSOC PED SEO RRC O COROT NCCE CO TCR SORE REEUCEDOER ERO OOR REPORTED LECUUPCCUCUODPOC CC CES ACEO COTTE OEE E CCE EUTEC ERE LOU ESE ESS OT EOTERECTECELOEEES TOR DCCOREACOUNESOSEOCOONERREEEDE H O U L E ‘ 5 : Artists’ Supplies ': A. S. INGRAHAM CO. Jewelry Gifts zi 52 Union St. 3 North Main St. Atteleboro, Mass. ATTLEBORO Albert Houle Emmar Houle :: Tel. 122 TUSCOODEUOOETEOSUCPS OUTED OOO ORORURELERODESOSDERRSEOCCORUURUCCSSEOET EE OPCOE DELCO ND OCOSESOROD ONES ACCES ET ODL UVACUANUOUUCUAGUOEUOHUOUUOUCO OCH UCQUUQUO OOS COOUERUOSOCUCEOCOOUDEOCSHENERUSSAUSUESUCGUOOEEEUSSEORUEN SEDER PLUTO LOU CLULC BLELEUE UO EE LELUC ELL UEC UUUUCORCU ULE. LEU EOL UCUUCUCLLLCCUDCLCLSsssGl CS CUCQnROURNODUCLC UOC TCROROGnCROR Co UUGRO Cn ne TGC hiro Coc Carne LiLc ncn nh cnieuoreecnn aii’ cur ae ne eR ES Een Oa i ales SRG ased iy Wek dene ee kee ULL LLULCLUCUU CLL UCC OCCU ICUCIO CG USUCEMOM OM OTC GHOOUC EO Wfea ubce PHIL’S TAXI Esl: NGESes : i 59 Park St. Attleboro, Mass. : Attleboro 231 ve : QUGUNGUOAUCODAUONSUCREOUGUOSHOUONOGRUSEOORAGAUCAECEUOGUSUUCUDOOEOROUOQUOODEQULOUUOUOOUOSUOEOODESECHSESED © COLUUONUOSOCCOGONCOUOCUDEDONCLUUOCUUDOOEOORDONCQCOCUSAUCOUARSOOEOUCLOUOOSOEEANISALRUEREGREOADONIaENAIIO oun Page one hundred twenty-two COPRCKUUNOUAOUDOEOCODCDOCCEDEDOCUODCOCDECGUE CEO OOOCCTCUSCEECE EUR OOASUCEEEROEECCOQUUCCECROCCGREEESSOCUOCCCURU ROR CROCCCCCUCCCEEERECCOCCCCCCCEDEROCEOOCRSNDTTERUT OCR CROCSSPOGEO EEOC CSCC ER ERE EOC SEOOCU SOOPER OROOTEEE EET EERE BEST WISHES FROM CLASS OF 1950 ee ea o a a bodercet an Oita num imiasininetnlanmmagenonmeninounnajenmundine Page one hundred twenty-three SHEPARD PROVIDENCE, R. I. Where You Always Shop With Confidence FURNITURE For Modern Homes Floor Covering Specialists Bostock Furniture Co. 10-12 Trescott St. TAUNTON, MASS. YOUR STORE. TUeUOUVADOEOORQUOUCOUO SOU EDEGEESERUECUUGEOCERUROEOECROCSEO SOO EDE ROSCA ECP CE DOSE OS ECC OSE CP EPERE CREEL EELS 1851 Established 1947 Before you were born COAL - COKE - OIL For Quality - Value - Service Phone 1250 Motorstokor Winkler Stoker Timkken Oil Burners STAPLES COAL COMPANY 35 Taunton Green TAUNTON, MASS. Page one hundred twenty-four SPEPPERURECEOCUU OCU CR EURO ECCT ECC CECE CDEP EERO CEP ER CDCR POOPED CCCP STEER COSC OPES STEP E SORES EERSTE SUPP UU UCPOCCO COUP UE EPEC Pee P ECE O SOE E EOP T AACE ESOP EPEC E PEPE E PEATE PRPS EEE P REESE PUEECCE OCCA PERE SPUCCOVCCUCCUCUSOCCC COCO CE OCOUEEOS CECT OCOREO EOCENE EECCCECEECCU CCU R PROPER EAPC E ESCO EEE P CEE C COCO CRP O RECOM RPPCSUCSSROCUUEOSUU ETOCS OOOO EEE CUUECRCCUUUEUCCTOUCCEEREREEULOUUCHOPOTTEORERECR ERODED OEE M. Stoll Company Established 1863 Wholesale Grocers and Distributors of CARVER BRAND Canned Fruits and Vegetables BOSTON, MASS. Wear the popular SPALDING “SADDLES” Smart two-tone style ; saddle oxfords with leather uppers, Plain Toe. Rubber soles, Wright Ditson TAPCO CC PUOEASCEE OCCUR SOCCO ND REC CECCCCEOCCCCUOTECCOOCCEECCPERESSECENSOCCEOROEEESEREEROSOCCOTEURURRD GOED COMPLIMENTS OF POUND UREOOROTTEU OCCU NEON OGR ooo eD Pine Hill Creamery BROCKTON, MASS. Plants - Cut Flowers ‘for Commencement - Weddings HALL, THE FLORIST 26 School St., Paunton Tel. 1422 Flowers Telegraphed Anywhere VURPPTOTEPUOUUIT TT ECS SE TCSRCU LO CUDED EEC tt teeter reir triviriiiiiiiititiiiiiii iii i iit iii lf its STYLE you want ts PLYM OUTH you want YOUNG PEOPLE DECIDE the style leaders and this year many of you are saying Plymouth’s the car. Convertible or club coupe, station wagon or sedan, you can’t mistake Plymouth’s advanced design. Smart new interior refinements match smartness of body line. . . flashing response teams with flashing appearance. Plymouth’s a car you're proud to drive or park anywhere. PERFORMANCE? YOU WANT PLYMOUTH! The new Plymouth’s engineered to co-operate with you from eager start through the whole wide cruising range. High horsepower sings softly as hills flatten out, miles fall away and you glide through traffic as it comes. More than 80 new mechanical improvements! THE LOW-PRICED CAR MOST LIKE HIGH-PRICED CARS VALUE? others has half as many as Plymouth! YOU WANT PLYMOUTH! Fine-car features make Plymouth the Top Value car. It’s the low-priced car with 20 of 21 features of high-priced cars. No other low-priced car has all these quality features. Of the three leading low-priced cars, neither of the PLYMOUTH Division of CHRYSLER CORPORATION CONVENIENCE? YOU WANT PLYMOUTH! There’s a handy control on the instrument panel to send your convertible’s top up or down. That’s just one example of Plymouth convenience. Another: look at the roomy, easy-opening luggage compart- ment of any Plymouth! The “lift” is built into the lid! Page one hundred twenty-five PVOCPETORPEOUUCCDEEOSADEUOUDRCENDASOUEDODEEOUSOUCOOEEUCO CT ECEO TE ECO SOE PE PREPAC PEEP R REE UE ER EEE CRE CCC CRETE, COPE PPC EDOEE SUNOCO CT EP SOE ACP ER OE COOPER EOE E PEO O ROPES EUECROREEORECHCOEOOT OR OTOREETEERSECOOR CHORE UTES EEEEES DURAND’S i CHOCOLATE SHOP =.= =.GLADDING’S Since 1766 19 Taunton Green TAUNTON, MASS. OOUUCOSREEE e VTOPEESUCCLSSOUNUOCQHDSSOCONCUOCUSOCUOEOSUEEOEOCOCOEEROCEUCCEN CUCL EUCECCESUAU COUPE UOEEUCOUEEC ESSER EDEL ED gins i ss nannunnnnnnnnnnnnnnnennnnnin :: One of New England’s : i Fine Stores Leopold Feldstein = Sweaters - Bathing Suits PROVIDENCE, RHODE ISLAND College Hill ii PROVIDENCE, RHODE ISLAND : CURCCUECECRCEEREOECEOCOCUCSCCESCCEOREDEC EEOC ED ED PER ASEDECEOECRESES CES EC EL ECG R EROS EEO EESEEOEEOEO EON PESTS || PRREEEODEGRODPNEE ODED ES ED ES SPER SERED OSPR OTL E DERE S PADD ASE E ACEO OSES OPEC SEES DUPER ERO R OOOO ROSE R APONTE ERE CECE EPEOPOPEEEECCE CCAP ECO REU RECO EPO R TOS OPPO CCE R SCPE ETOP ERENT EEOC E SEER E EPP EE ERPS REC EE PEER EEOC CEE © POPES EASE EMD EU CORSE RASC R POSE OCR PURE UTA A COUN RECORD ORR D CRORE CRUE O RCC R EC UR SOOPER TPE RR CCU O SCPE EEE E SOTO R EEE COMPLIMENTS OF Dole Bailey, Inc. THE PINE ROOM ) 19-23 New Faneuil Hall Market BOSTON, MASS. Norton Mass OCURMRSOCRER OTR E OTR R ORR O RCRA DRE CC HOHE CCRC RENEE UREA RCH O KAU C COREE ae oeae CUCCCOROASEU RDU CER SERRE CCRC RECAP RPE H TOR C UO PERRET CEES RCE CHEER PERE R ECR O DEUCE OTERO F TUCPPOUCC PETE AC EERE RODEO PERE TIP CRATERED OCOD EEE O RUE TO SES TEEPE EPO PPE O REE OC EER S CCE ECUEESROCRECOSSCRENCROE FOCCREEEODER TORE DEUEO OSE REDEEE ESOC CPO U POPPE CCP PRTC EEO POO SU UUC UU UUUUUUU UOC UUUUUUUUUUUULUUUUUUUUUGUUUULL LLL MOCUDENCUECCOCEEECCER ORCC CERO OUTERENSECE CORRES OORCEOCORCOcoteeES Mansfield 300 24 Hour Service COMPLIMENTS OF IDEAL TAXI Musto’s Beauty Salen Everett Bennett, Owner 181 No. Main Street Mansfield, Mass. Tel. 770 Page one hundred twenty-six STUUUUO OOOO UCU UUUUUUIUUROUUU UU UUUUUUUUURUUOOUUUUOUUUUUUGGUUUUOUUGUUUUUUIUUUILILUGUUUOUUUUUUCUULULLL TOPCO ATO RCO O OUP ORC RTOUU OU OUTOTT NEURO POP PCCC CE UCCCPCCED EO ECCU EPEC CT EPE CCU EE CECE EET OPEC CCC C EE CR PO EE PEERS EEE NORTON, MASS. PTTPTT TATU ALT S TCSP CPO TIO G UOC CC COCO C COCO UCUCOO CUCU OUUCUUCUGUUUUOUUCUUGUGUUGUUUUUUUGUGUUGUUGUUUUUL ULL LULU LLL COOUPUCER OD EOC OOM ACEO PERSO GEE M RS ORE EERE OCP PTH E ROPE CCC C CNPC RON APP OHA THRE OURO R CCU S RPE U EASON CHOP ERP U NEP RN OURO RS OCU NCES PEO RC COSCO ERROR PESOS EPROP ROO O OEE Page one hundred twenty-seven WOUUOUEDEOUCECUCECCOOOCE TORU COCEEUEOCOEOEPERESROOSUO REE EPECUREROCS OPER PEE CERPEMECORSEC TATA DRE EOCCCCCECCC CRORE TOURER CERES SURE RU GCC ECE CURCOSHCCCURSCEO SERS C ESOC CEC CREDO CCAM CCRUCAASSS ER OR DEERE PROCES TO EEE CREE DORE SESE COMPLIMENTS OF PRATI'S STORE NORTON, MASS. Established 1903 Avery Clapp, Manager PPTTTITITITETTL ETT TTT TTT TT nT Page one hundred twenty-eight (OUDERUSOUCEAROOECOERCRCONCURUGEACECCU REC RCOROUEUOCUSOTO RUUD ECO ECCOCO SES EDORCCS EEC ENS ERS REO ECR HOS COCR EOC PES POSES RECO CC EAS R EC KOS CECH PSEC EES CECE COSCO RDCR REE EOO REGS ET EAERERE RCC OSO CES RUEEORS EES E HUET OC ECOR ES ORT ERASE BREEN ETERS Once again the NIKE reflects the life and spirit of Wheaton College Complete photographic service by SARGENT STUDIO 154 Boylston St., Boston Photography - Design - Technical Assistance SOUOCPSCOOSUOREEROLSHDREEED UPAR E ADOC CONGO CSTR AUC ORC UNCC CATA ACCC ECO O CAPER CLO U OPEC CEU U PETC C OPEC OCC M UDOT E ATCA OOOO CCRC EPAPER OPEC OCCA CARO D ACEC UPR GO AONE CRON AEROS OSES PORES ACHE CCST O ERPS TPA TA EDO R CCE CO UOC O RE ECOESCOUOEUNEES OCH ESOP EDO ERECREREONELOSOEOECHSRUORC ACR RAN EDO AS ESRC POMP ORO RRORREOED PEPIIIIIIILILI Tt EEEPELELLELiiilLilitiitiilililii ieee iil ieieliii ili iis teri eliieiiiiririiiiisiiiii titi sii iii iii iii iii titi Pees eritiieiiierii iii rite tit ii itis iii siti iii iii titi ii iii iii titi tiitietiv i iiititiiiliiiiiiiiliiiliiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiy VPOUEUSECECOECOCCUCOCOUCUOCEUURCUNCUUOOUCCCUCUEOOCUEOCEOORCUUCCRUESUECE OURO ROCCUOCUCCUOCOESCCOEOECORCUCUOCORUEOU CCF ECERUEOEOOCOEOOUCERUOCENOO URE CUCCEEE CCS EUEOE CO EUETORCUUCEEQECQ ESET RSE RCCOU PATIO PUES ECCEVEGEOEEREOREREOEE Page one hundred twenty-nine 7 4 a “JAHN OLLIER AGAIN” The slogan that’s backed b y genuine goodness in quality and service, the result of 43 years successful experience in the yearbook field. We find real satisfaction in pleasing you, the year- book publisher, as well as your photographer and your printer. JAHN OLLIER ENGRAVING CO. Makers of Fine Printing Plates for Black or Color Commercial Artists - Photographers 817 W. WASHINGTON BLVD., CHICAGO 7, ILL. Printed by The Benton Review Publishing Co., Fowler, Ind. Page one hundred thirty coe Frappe i seer eras pot itet Se teaser Rede ears Seam, sae