Oil City High School - Oil Can Yearbook (Oil City, PA)

Text from Pages 1 - 166 of the 1945 volume:

The 1945 GLQ Can We left Junior Hi . . . to become Freshmen at Senior 2 Edliwmat .Staff C7 'Voilumf-1 XXQW Editor in Chief ...... Assistant Editor ....... Co-business Managers .... Literary Editors ....... Art Editors ..... .... ...., Photography Editor ...... ..... Senior Hi News Representative. . . Junior Editor .......:........ Sophomore Representative ..... Faculty Adviser ......... T N2 we Qr4 I yy Illkwx W 5 M v I1 P , i4 A 'x G f9 lflaw y s ' 'll X 'll XXX U . . . . ..... John Greenawalt ..................NancyHose Joan Cavanaugh, Lee E. Hanna .Louisa M. Urey, Frank Swacha . .Virginia Kifer, Vivienne Kifer ................Hobert Logan ...... . , . , .Jeannine Stoudt . , . . . . .Harry Hetriek . . . . . . .Bay Schoch . . . . .Warren J. Anna . at first we didn't know whether to be glad . . . or to be sad . . . onewoncll After long hours of tedious work, months of planning and preparations, We present to you the re- sults of our earnest efforts-the 1945 OIL CAN. p We have endeavored to recapture the spirit of Senior High School and preserve, forever, a few of the most cherished memories of the happiest days of our livesf, ln this, We hope we have sueeeecled. We were the first group to enter Senior as freshmen 4 -ad s T Q ga, ,,,L ,.,,. , ,,,, H-Wy, ,,.y,,. , K, ,Q 35 Q TW..,,w Cfnllimta to Jlnmecll Senuicea ' May we pause for a moment to pay tribute and respect to all those who have gone from Oil City Senior High School to play their part in making this World a better place in which to live. It was different . . . very different . . . we were now the most insig- nificant of creatures . . . 6 qaculli in Sz-:nuica ll Vaughn DeLong-Superintendent of Schools Martha Morrow Fleming Smith Michael Knerr James Smith Oscar Collins i Joseph Macalka Nobodyls baby . . . ignored by the Seniors . . . loathed by the Juniors . . . despised by the Sophs . . . WE were Freshmen . . . tiny and obscure! 7 S 1 SD:-:dlication The class of 1945 hereby follows the custom of previous annuals in dedi- cating our Oil Cani' to that person who has contributed most tellingly to the success of our class activities. It is not unusual that this person should be our adviserg but it is unusual to find an instructor so devoted to his task as Warren J. Anna, for two years our counsellor. We humbly voice our deep appreciation of Doc's,' efforts, Where's the elevator? . . . E-e-e-k . . . study hall nothing . . . that's the girls' gym. 9 Cfaltille ot Conte nth Page 3 Editorial Staff 6 Tribute to the Armed Forces 8 Dedication A 12 Administration 17 Faculty 26 Maintenance and Utility Staff 27 Cafeteria Staff 29 Underclassmen 37 Organizations Sports ...... . .. Page Dramatics ..... ' Music ..... Oil Can ........ School Groups ..... 88 Seniors Alma Mater ......... Sigma Kappa Sigma ..... Prom King and Queen ..... Football Queen ....... . X Events and Officers ..... . . Graduating Senior Officers .... Seniors ..... ............. Senior Superlatives .... Senior Activities ..... 131 Advertising 38 51 58 67 70 Page Agony, agony, agony . . . our first taste of Latin . . . will we ever forget it? . . . 11 Jlcllmlnlatnation MR. JAMES A DeFRANCF1 I Superintendent of Schools QActingj P MR. M. W. HEMPFIELD Secretary of Board of Education We made new friends . . . ones who were to remain faithful and loyal . . . through the next four years of . . . ' 12 dfloancl of gclucaticm Seated, left to right-Mr. DeFranee, Mr. Ziegler, and Mr. Mohnkern. Standing, left to rightMlVIr. Hempfield, Mr. Fitvh, Mr. Lilly, Mr. Clark, Mr. Luce and Mr. Logan. i Superintendent ...... .... M r. J. A. DeFrance ' President of Board .... ..... M r. E. W. Ziegler Vice President .... ......,. M r. H. J. Fitch Secretary ...... .... lv lr. M. W. Hempfield . . hell-0, Tom . . . we were even beginning to speak to the Seniors . . What if they didn,t answer? . . . 13 MR. CARL H. TOWNSEND Principal MB. JAMES D. TOWNLEY Assistant Principal Administration ,We elected class officers i +14 MISS ROSE MEDITZ Assistant Principal Attendance MH. JOHN E. ENGLISH Assistant Principal Guidance MR. GEORGE P. KARLE A Vocational Coordinator Pearl Harbor, December 7, 1941 . . . WAR! . . . it seemed impossible and far away . . . ' 15 I MISS ALBERTA SZAFRAN Secretary to Mr. Townsend MISS MILDRED ECKMEDER Secretary to Mr. Dc-:France MISS VEBONICA PATZ Secretary to Mr. I-Iernpfield the Senior Broadcast . . . practically our first chance to show our ability? . . . we jumped at the opportunity . . . and showed prom- ising talent for the future . . . CZfacuQtl3 W gh Dir. Russell Buckham Oil and Gas Shop Ground Floor Room 6 Nlr. David Faust Auto Shop Ground Floor Boom 5 Nlr. Eugene Hill Elementary Machine Shop Ground Floor Room 1 hir. George 1NIcAlevy Industrial Arts Ground Floor Room 3 iWlr. iwartin iVlills Advanced Machine Shop Ground Floor lloom 4 Mr. Edward N. Roberts Blueprint Heading and Mathematics Ground Floor Room 2 iWr. Vance D. Brown Related Science, Mathematics, and History First Floor Room 104 Miss Vict0ria.Davis Art First Floor Room 102 hlrs. lwildred Hazlett Civics First Floor Room 123 Mr. J. Francis Houtz Boys' Gymnasium First Floor Gym Mr. George Karle Coordinator, Vocational Education First Floor Room 103 Mr. F. LaMonte Lewis Dramatics, Public Speaking First Floor Room 101 llliss Helen ltlackenzie Latin, Algebra First Floor Room 106 Miss Margaret Reid General English First Floor Room 112 bliss Anne Smith History First Floor Boom 113 Miss Maxine Templeton Commercial-Junior Business Training First Floor Room 122 lllr. James D. Townley . Art, Mechanical Drawing, Assistant Principal First Floor Room 102 Mr. John J. Connors ' Chemistry, Aeronautics, Football Coach Second Floor Room 206 llliss Beryl Eddy French, Academic English Second Floor Room 211 lVIrs. Mary E. Harlan General Science, History Second Floor Room 204 Miss Jean lllackenzie Latin Second Floor Room 223 Miss Rose llleditz Academic English, Assistant Principal Second Floor Room 222 Mr. Harland lllitehell Music Second Floor Room 203 Miss Hazel Orcutt General Home Economics Second Floor Room 201 Mrs. Jeannette Polansky Vocational Home Economics Second Floor Room 202 Mr. Dana Pringle Physics, Radio Code, Junior Adviser Second Floor Boom 205 lllr. Philip Runzo Music Second Floor Room 20 llliss Florence Stevens General English Second Floor Room 224 lWIr. Warren Anna Biology, Senior Adviser Third Floor Boom 306 lVIrs. Esther Duink Arithmetic, Product Study Third Floor Room 305 Mr. John English Mathematics, Guidance Director, Asst. Principal Third Floor Room 323 Bliss Helen Fogle Commercial-Shorthand Third Floor Room 324 Mr. Albert Foster Social Studies Third Floor Room 322 Miss Ruth Kammerdiener Commercial-Bookkeeping Third Floor lloom 342 Miss Henrietta Leyda History Third Floor Room 341 Miss Audine Stanley Commercial English Third Floor Room 343 Mr. Russell Ward Arithmetic Third Floor Room 304 Miss 'Eleanor Hoy Librarian Third Floor Library lVIrs. Eva Bartlett Girls' Gymnasium Third Floor Gym lVIiss Louise Caldwell Mathematics Fourth Floor Room 442 Miss Ethel Cubbon History Fourth Floor Room 441 Miss Evelyn Moyar General English Fourth Floor Room 424 Miss Margaret Nelson Academic English, Journalism Fourth Floor Room 443 Mr. Thomas Nelson Commercial-Typing Fourth Floor Room 422 Bliss Dorothy North Commercial Fourth Floor Room 411B Bliss Edith Pinney Commercial Fourth Floor Room 4ll . . had our own football and basketball teams . . . . . read Hlvanhoei' . . . Received our first edition of the Can never dreaming that our day would come . . . ' N - nk 'k 'k ir 'A' i' ' Our Sophomore year brought many changes . . . the war was being felt closer to home . . . A Many of our former teachers were in the service . . . . . . black-outs, scrap-drives, and air-raid drills become common occurrences . . . maybe these made us grow up . . . anyway, we began feeling more like high school students 22 Broadcasting Boom Al Lee and Muzzy . . . most of the same studies remained . . . but some new courses were added . . . pre-induction was required for boys . . . 23 1 1 4 l I w N 1 24 L I cwlaintenancze Mr. William West Dr. VV:-:lty Mrs. Schubert Dr. Rairigh Mr. Beryl Myers Supply Clerk School Physician School Nurse School Dentist Attendance Officer flflufliuy Smit Y f-nur ,-we 'VM -v f V' f f -- '- '-. aim -11 A + 1, ' 7 K ' - Mr. McFall, Mr. Lewis, Mr. McDaniels absent Mrs. Muldoon and Mr. Kiskadden . 26 Catch-:nla .Statt i Left to righi-Bramhail, Shaner, Perry, McKenzie, Mr. West . . . gas rationing started . . . driving stopped . . . but parking con tinued . . . it was the same old grind, same good, clean fun . . . 27 V I 1 1 28 clllncllencllalmmen A junlon Cllcum Cttlce-:na , John Ziegler ....... . . . .... President Mr. Pringle .... ......... A dviser Dean Grazier .... ..... V ice President liutlle Tucker ..... ...... S eeretary Elizabeth Master ,.,. .... T reasurer The team registered our first football win in three years . . . the re turning material looked promising . . . 29 ROOM 123-MRS. I IAZLETT First llow, left to rightkldzi, Puleo, Winters, Mast Myers, Martin, Pliska, Schott, Whitehill Powell. Second How, left to right-Mrs. llazlett, Jacobs McGee, Bell, Cann, Budzinski, Potter, Dudzic Trzuskot, lluff, Duarte, Say, Harmon, Badach Third Row, left to rightADehner, Pacior, Sweeney Lindsey, Karasinski, Mallory, Ramp, Kerr Morgan, Knowlton, York, Speer, Wnuk. Fourth Row, left to right-Neil, Dick, Pertz, Ross Murphy. ROOM 122-MISS TEMPLETON First How, left to right-Schoonover, Wade, Dille Ilamsey, Jerko, Shafer, Oxenham, Hardie llenderson, DelVlarches. Second Row, left to righ t-Toy, McFadden, Patter' son, Shannon, Spence, Gahring, Fike, Greer, Falkenburg, Slater, Mohnkern, Burnett. Third Row, left to riglit-Miss Templeton, Gricks, Goreezny, Burnett, Niemiec, Wilson, Dollard Tarr, Paeior, Barton, Walz, Klapec. Fourth Row, left to right-Dollard, Campbell, Irwin, Finnefrock, Burda, Smith, Cieplechowicz. ROOBI 113-MISS SBIITII First Row, left to right-Gray, llembold, Lenser, Pierce, Powell, Downs, Dunlap, Black, Skelly Williams. Second Row, left to right-Detar, Brown, Coogan, Hunter, Barnfield, Knowlton, Taylor, Toy, Spence, Smith, Way. Third Row, left to right-Robinson, Vlfhittall, Hannon, MeCrea, Loebelenz, Moore, Butiste, Peters, Austin, Taylor, limanuele, Straub. Fourth How, left to right-Porter, Lyons, Galysh, Zuilkowski, Kirkwood, Tamburine, Buchna, Pierce, Arthurs, Forbes, McGee, Allison. lemember Bugology ' letis amputate . . . Ugh! a 1 1 s ROOM 112fMlSS REID First Row, left to rightYlVlcSparren, Mcflillicuddy, Knox, Horn, Hanson, Florek, Kindelbergcr, Dunkel, Cartwright, Cavanaugh. Second Row, left to right-Smedley, Applequist, Russell, Yost, Yoit, Smith, Ross, Pritchard, Highfield, Hoover, Mozur. Third Row, left to right-Schneider, Fesenmyer, lleintz, Enos, Mason, Russell, Perrine, Nune- maker, Salsgiver, Waters. Fourth Row, left to right-Britt, Bryan, Frank, Thom son VVilliams Strickenberffer, Thomas, P v v Guyda, MUl'f3y, llolingsworth. in ROOM IOSYMISS MACKENZIE First Row, left to right-Cook, Lambert, Wilt Kinch, Strycher, Sharp, Schoch, Ryhak, Rice Fitch. Second Row, left to right4Miss Mackenzie, Arth urs Deyoe, Winger, Burns, Rennacker, llafer Rennacker, Lewis, McCrea, Lewis, Graff Lauffer, Boring. Third Row, left to right-Schell, Erickson, McGill Anderson, Steele, Steck, Kerr, Griffith, .letter Evans, Marshall, Dumpe, Elliott. Fourth Row, left to right-Fassler, Bieliski, Perrine Payne, Van Ausdall, Schultheis, Keener, Knight Brown, Townsend, Talley, Deist. ROOM 204-MRS. IIARLAN First Row, left to right-lVloyer, Buzzard, Nlurray Wilson, Belle, Garmong, Reeves, Nelson Wygant, Jarzab. Second Bow, left to rightfM rs. Harlan, Goodemote Tenza, Olszowska, Spear, KHCDP, Sullivan Carhaugh, Wolf, Birsa, Evans. Third Row, left to right-Huefner, Riley, VVilson Collins, Becker, Mild, Meade, Kline, Riley Nelson, Rhoades, Wice. Fourth Row, left to right-Jasiota, Bakerf Drelick Stahlman, Carlson, Flojnacki, Weber, Gates. . . . ,though Sophs aren't too bright We led the honor roll several months in a row . . . Hbrainsw, huh a s a ROOIW 304-MR. WARD First Row, left to right-Hurst, Sigworth, Stephens Wise, Toy, Hefferman, Gaisford, Reed, Sibble Spence. Second Row, left to right-Holquist, Martin Williams, Collins, Weaver, Martyna, Aites Hulsizer, Lowry, Thompson, Saboski, Drake. Third Row, left to right-Fry, Bills, Erwin, Eis- mont, Ruth, Snell, Roser, Rogers, Verner Rankin, McDaniels, Kimes. Fourth Row, left to right-Bowersox, Gonzales Price, Russell, Graham, Durnell, Snyder Anderson, Settlemire, Andres, Stubler, Mohni kern, Rybak. ROOM 305-MRS. DUINK First Row, left to right-Lockwood, Trotter, Spence Bell, Rankin, 'Reasor, Bell, McLaughlin Bucholz, Bennett. Second Row, left to right-Brozeski, Rodgers, Reese, KlfJSlHSkl, Poweska, Gibson, Burt Marshall, Deeter, Hepler, Crawford, Heath. Third Row, left to right-Speer, Smalley, Dunkle, Rowland, Samora, English, Gannon, Clute Robertson, Reed, Urey, Rennard. Fourth Row, left to right-Lolley, Vogus, Sharrar, Struss, Cauvel, Carter, Boyles, Noxon, Pullease Jones, Olszowska. ROOM 306-MR. ANNA First Row, left to right-Young, Messer, Daily, Sehreffler, Thompson, McLaughlin, Roos Miller, Koontz, Smyth. Second Row, left to right-Goss, Kofford, Kohlman, Bueholz, English, Frantz, Carson, Snyder Harrison, Thompson, Pearson. Third Row, left to right-Mr. Anna, Spence, Ander- son, Filson, Dodds, Condon, Irwin, Ludwig, Pleger, Shannon. Fourth Row, left to right-Wilson, Bruno, Barnes, Sehoeh, DeFranee, Collins, Patterson, Kenney, Biltz, Montana, Johnson, Bowser, Kinnear. . . . Student Council was reorganized . . . and showed more vim and vigor than ever . . . 9 a y s a 1 1 1 9 ROOM 423-NIR. NELSON First How, left to right-Baily. Bixler. Lesh, Porter- field, Ausel, lVleFadden, Goodwill, MacDonald Huff. Second Bow, left to right-Calahan, Conway Simona, Wlilson. Yogus, Myers. Wolfe. Mika Knepp, Karns. Third Bow, left to right-Aber, Aikins, Barnes Firster, Stiller, Clyde, Thompson, Tarr Schneider. Fourth Bow, left to right-Frankinburger, Budzin- ski, Bower, Malys, Konetsky, Hartman, llolz Heekathorn. l ROOBI 424-M l SS IIOYAR First Row, left to rightslferguson, Plowman Henderson, Prestipino, Nlurphy, lVliller, Paeior Pringle. Second Bow, left to right-George, Budisky, Mc Fall Brouin, Moyer, Dolby, Baughman, Colnen- baeh, Brandon. Third Row, left to right-llanna, Reiehart, Heintz Malys, lludieh, VVujich, Smith. Johnson VValters. Miss Moyar. Fourth Bow, left to right--Gegogeine, Hodge Slater, Czlonka, Samora, Smith, Hare, Remus Brumbaugh. ROOM 441wNl ISS CUBBON First Row, left to right-Nagle, Rosenberg, Fuller Donley, Hagan, Kerstetter, Arras, Curran Bayne, Beightol, Brown, Sehwahenbauer. Second Bow, left to right-Stanton, Benton, Sawat- sky, Allen, Collins, Diebold, Kirchner, Atts Gill, Koltonske, Koweski, White, Hopwood. Third Row, left to right-Miss Cubbon, Lynch Stevenson, Thomas, Winger, Quattro, Jones May, Weiford, Witmer, Nieewonger, Hartsell Hefferman, Mietus, Josephine DeMarches Eva DeMarehes, Egan, Van Dyke. O . . . Hwily Wizard contests were popu ar with the sports en thusiasts . . . 1 ROOlW 443-lWlISS Pl NNE Y First Row, left to right-Bahr, Batini, Pearson Uiehl, Erhert, MoNernev, Murray, Wilt, Hess Sovond How, left to right-llfliss Pinhey, Dauben- speck, Swacha, McKean, Marki, McKean Last, Filipowski, Culbertson, Roddy. Third Row, left to right-Aites, Wolfe, Moran Vlfeaver, Moyer. Womer, Stephens, Smith lloaly, Colvenbacli. Fourth How, left to right-Campbell, Fields Arehible, Rinolla, Connelly, Bills. ROOIVI 442-MISS CALDWELL First Row, left to right-Wood, Hawkins, Kern llinske, Carrier, Evans, Kowal, Dolecki Farrell. Second Row, left to right-Welms, Stoughton Gordon, Kerr, Oakes, Ames, Hepler, Lamberl ton, Fleischman, Leskoske, Miss Caldwell. Third Row, left to right-Stewart, Downing, Clark, Fesenmyer, Latta, MeCash, Anderson, Lewis, Mohnkern, Galysh, Allebaeh. Fourth How, left to right-Barrett, Roberts, Jetter, Erickson, Fry, Slater, Bills, Lane, Meals, Rodgers, Hollenbaugh, Stormer. ROOM 343-MISS STANLEY First Row, left to right-George, Karns, V an Dyke, Cauvel, Thompson, Strickenberger, Berlin, Lewis, March. Second How, left to right-Anderson, Elder, Kelly Conklin, Hinds, Moore, Oleksak, VVnuk Williams, Hipwcll. Third Row, left to right-Anderson, Saboski Kowalsky, Ames, Exley, Jarzab, Olzewski Giltinan, Smith, Whitten, Sullivan, Repman Howland, Sampsell, Barsez, Lenser, Krug Capanero, Dolby, Frankenberger, Behringer. 1 9 u s n a ROOM 32443Il SS FOGLE First Row, left to right-Mumford, Blanchard Baker, Perrine, Polly, Ausel, Malcolmson Felmlee, DeArrnent. Second Row, left to right-Henderson, Cann, Shaw Osterman, Matha, Ausel, Rodgers, S0ttl6II'Il1'6 Conf er, Cunningham, McGrath. Third How, left to right-Burnett, DeLong, lryvin McCray, Kahle, Sottiaux, Collins, MHZIHTZ Martyna, May. Fourth Row, left to right-West, King, Mascin Lutz, Fisher, Barlog. Missing from picture Rinnella, Stierly, Yez. ROOM 323A-MRS. POLANSKY First Row, left to right!-Hookins, Poweska, Harper Dreher, DeWalt, Finnefrock, Croft, Cook Davis. Second Row, left to right-Ziegler, Watts, Masters Kerr, Miller, Daily, Lange, McCoy, Hinske Vescoe, Nuhfer. Third Row left to ri ht-Stuck VVa Parker 1 3 - Y, Hetrick, Seidler, Culbertson, Breaden, Dauben- speck, Graham, Goldberg. Fourth Row, left to rightf-Baum, Kineh, Quinn Nelson, Ward, Kerr, Serafin, Levi, Weaver Young, Baumbach. ROOM 341-DIISS LE YDA First Row, left to right-Payne, Redmond, Hnglert Smith, Jetter, Stevenson, Bower, Gallagher Stahl, Carothers, Courtney. Second Row, left to right-Fornof, Ryhak, Roydes Klos, Ward, Wenner, McFadden, McLaughlin Lee, Tucker, Shaw. Third How, left to rightABuckharn, Kistler Stormer. Taylor, Mills, Johnson, llill, Cook lVlurray, Grazier, Mott. Fourth Row left to ri ht-Dolb Crowe Hannon f , S Y, . Goldberg, Shaffer, Rembold, Rhoads, Foster Anderton, Seraf in, Simrners. . . . made names for ourselves ln A Cappella, band and orchestra some of us even learned to dance a ROOM 342-MISS KAMMERDIENER First Bow, left to right-Bell, Baker, Rubino Conway, White, McGreevy, Frankenberger Leake, Miller, Tenza. Second Bow, left to right-Baughman, Mclilhatten VViekal, Gutowski, Sherrick, Bernhardt, Hynes Carter, English, Byczko, Gharing. Third Bow, left to right-Thompson, Amsdell, Buday, Bubino, Cieplechowicz, Johnson, Felm- lee, Tarr, Powers, Bizzonc, Gollasch. Fourth Bow, left to right-Konen, Kay, McLach- lan, Smith, Glaz, Snyder, Russell, Flockerzy, Potts, Taylor. AUTO BIACHINE SIIOP First Row. left to right-Decker, Davis. Koszalka, Fink. Miller, Jackson, Bills, Fornof, VVarring, Mr. Hill. Second Bow, left to right-Mr. Mills, Baer, Mc- Donough, Sprague. Zyck, Skiba, Stevenson, Glasgow, Irrgang, Hamilton, Duncan. Third Bow, left to right-Zyck, Pearson, Gault, Skiba, Szabat, Remus, Klinko, Fitterer,Hajduk, Beichart, Thompson. Fourth Row, left to right-Socha ,Connor, Henlen, Idzi, Kresinski, Warcholik, Barscz, Brown, McCartney, Smith, Neely. MACHINE SHOP First Row, left to right-Mr. Faust, Garback, Boss, Pfendsack, Weiser, Driscoll, Driscoll, Dudzic, Makowski, Mr. Roberts. Second Bow, left to right-Mr. Brown, Foster, Rehberg, See, Donaldson, Wiltanger ,lIolqucst, Higbee, Reed, Wilbert, Fedorek. Third Bow, left to right-Geary, Karg, Pritchard, Driscoll, Bekiel, Sunseri, Foster, Farren, Ward, Ogle, DeSanto. Fourth Bow, left to right-Maier, Carter, Thomier, Manross, Coles, Scierka, Clark, Miller. . . . roared at '6Tune Inv . . . first girls swing hand was organized . . stiff competition for the boys 1 Cnqranlgationa 38 Sponta 51 fllnamatlca 58 Cwluaic 66 - CUZ Can TO School Qnoupa We felt like veterans at the Senior Broadcast . . . shook with fright at the annual mystery play, Hwings Over Washingt0n.,' 37 ootlicdlll Summcuug ot the .Seaman I The Oilers ended their current grid season with three wins, two ties, and five defeats. Although, the season's record is against them, the Oilers were a better team than the scores indicate. The Oilers started off on the wrong foot with a 7-7 tie with Titusville. Grove City trimmed the Oilers 443-0, Bradford topped them 18-12, and Warren eked out a 13-9 win. Starting with the Franklin game the Oilers started rolling with a 20-0 victory. Meadville cashed in on a break and took the Oilers 13-6, but the 'next week the boys took a close one from Greenville, 7-6. The Oilers came from behind in tlie last quarter to tie a heavily favored Butler team, 6-6. The following Friday the Oilers took Franklin, for the second time, 18-0. Playing at Jamestown, New York, on Armistice Day, the New Yorkers scored twice in the first five minutes to whip the locals 14-0. Four veteran linemen will be lost to the Oilers by graduation, but the forward wall will be strong next year with such replacements as Miller, Wood, 11. Parker, Gault, Dawson, Kineh and J. Henderson. Five hard-driving senior backs will he replaced by Dodd, Quinn, Zyck, Amsdell, Grazier, and Ziegler, whose absence this year was due to a knee opera- tion. SEASON'S RECORD Oil City r,rrr,,r,r . , ,, ,,r. 7 Titusville.,,,,,. Oil City fr.rr,,,rr. ,,ri... 0 Grove City fcrc,,r.. Oil City ,.,,i..rr ,.,,.,. 1 2 Bradford Y,..,,.,. Oil City r...r,r,,. r,,rr.. 9 Warren i,r,,,ci Oil City ,,rii,,,,r ,,,.... 2 0 ' ' Franklin irc,.r., . Oil City ,rr,,...,. ,r,.,,, 6 Meadville ,,,r.,.,,,r Oil City ,rrr,,..rr rr,.r,, 7 Greenville. e,c..,r r Oil City ,,,,,...,r r,rrrrr 6 Butler ..,c,,.,Y,,,,,,,... V 7, Oil City ..,...,,.. rr,rr. 1 8 Franklin ,,,,,,Vc,c.,,r,,r,,,,,, .Oil City ..,.....,. .,,,.,. 0 Jamestown, N.'Y ..., C, A Cappella celebrated its tenth anniversary . 39 Qrtldlinon Cfoae MPA Ed Vandenberg-Tackle-Although 6'Yandy', broke into the season late, he played the kind of ball that makes a winning team. Opening holes and Closing them was Yandy's,' assignment, which was well carried out. Dick Stoughton-End-Dick was a level-headed captain and an all-around end. Cool under pressure, Dick kept the Oilers out of trouble with his beautiful punting. Jack Greenawalt-Quarterback-'iGreenie's bullet-like passes usually found the arms of a Waiting teammate. His defensive work kept the Oilers together in a hard game. Dave Pearson-Center-An outstanding center and line backer, Dave played a stellar role in football this year in backing up the line. We will always remember Dave's art of drop-kicking. Bob Reinsel-Tackle-''Rubeisi' outstanding ruggedness in the line made him one of the best defensive and offensive players the school has turned out. John Schelle-Halfback- Huck is the one who tossed a beautifulpass to Stoughton to set the stage for the Oilers' only score against Titusville. Strictly a team player. John Gray-Halfback-:lack intercepted a pass and raced fifty-six yards for the Oilers' only score against Meadville. A deadly tackler on the de- fense. Gayle Parker-Halfback-''Windyl' was an outstanding baekfield man. His running, passing, and defensive ability Was Well shown by Gayle this season. Ray Karns+Hal,fback-No grass grew under his feet, for when Ray got in the Clear, he really burned up the yardage. The Oilers will lose a good offensive back in Hay. ' ' Sidney Reese-Manager-The only two-letter winning manager to Come out of the school, HDoe Reese has played an important part in our football year. His loyalty to the squad will never be forgotten. . . . many of us attended our first Prom . . . and before wc knew it we were upperclassmen . . . 41 1 X 1 43 Gilda kat lialllt .Summanyf of the .Seaman The Oilers picked up speed after having a slow start to wind up the season with a record of 14 wins and 4 losses. 'We placed second in league competition but thc using of an ineligible 'player by the Titusville Rockets hurt the Oilers' chances for the Section II title. Jerry Wood, lanky Oiler center, tallied 169 points to lead the individual scoring of the Oilers. Three other Oiler members were also over the century mark. Six seniors, Jack Greenawalt, Dick Stoughton, Dave Pearson, Ed Vanden- berg, Gayle Parker and .lack Gray will be lost 'by the Oilers upon graduation this year. . l The JV team had another good season, losing only three games, While piling up a record of ll victories. Royal Parker lead the scoring with 97 points. SEASON'S RECORD Oil City Farrell ..... Oil City .... ..,. F ranklin ..... Oil City Franklin ..... Oil City Rocky Grove Oil City .... .... G rove City. . 7'tOil City Franklin ..... Oil City Cranberry. . . Oil City Greenville. . . ,'tOil City .... .... M eadville. . . 'Oil City .... .... T itusville .... 9fOil City Warren .... :Oil City Franklin ..... O11 City .... .,.. Grove City. . Oil City St. Vincent. . 'tOil City Meadville. . . Oil City Rocky Grove ltOil City Titusville .... ,'tOil City. .g ..... ..., f 11 Warren .... .... . 36 'League Games. Ah, yes . . . the life of an upperclasslnan . . . what diginity, what poise, what-dopes . . . 45 dfluchet-Slnhana ot 1945 Jack Greenawalt-Forward-6'Greenies' ability in the back court and superb defensive play was an asset to the team all season. Although small, i'Greenie', made it up in speed. Dick Stoughtonv-Guard-Dick was a steady performer who put his heart in the game. His ability to come through with points when needed together with his excellent faking kept the Oilers out in front. Jack Gray-Guard-J ack proved his ability for the game by his aggressiveness in a ball game. His ability to get the ball off the bank boards plus his steady floorwork was an asset to the Oilers. Gayle Parker-Guard-Gayle was a player who gave his all to the game. His feeding of the ball to a cutter, tricky passes and long shots -from mid- court were a big help to the Oilers. Dave Pearson-For-ward-Basketball is another sport in which Dave partici- pates. A flashy forward and a good shot, Dave helped the Oilers' through a successful season. Ed Vandenberg-Guard-Vandy was l n getting started as he hurt his knee early in the season. Once he got going, he proved to be a good man under the basket. Dick Payne-Manager-HThe Oilers' manager in basketball was Dick. His good work and loyalness to the team and players will be remembered by all. I Junion iakiiqh Uflaaketlvaff Squad First Row, left to right-Dehner, McDaniel, Schell, Dick. Second Row, left to right-Walz, Urey, Erickson, Reid, Koerner, Coach Houtz. Third Row, left to right-Stubler, Settlemire, Nunemaker, Cook, Emanuel. 47 i wana, ro First Row, left to rightaHenderson, Stoughton, Reese, Pearson, Ziegler, Dodd. Second Row, left to right-Wood, Dawson, Greenawalt, Gray, Cault. Third How, lefl to right+-Vandenberg, Heinsel, Amsdell, Zyck, Schell, Parker. The Varsity 'KOH Club was resumed this year in Senior High School after a period of idleness. It is a club composed of football and basketball letterrnen. Coach Connors was chosen as the club adviser. During the year, various activi- ties Were sponsored by this group. President .......,........ ...., l lichard Stoughton Vice President ..... ,....... S idney Reese Treasurer ...... .... D ave Pearson Adviser .... ..... .l . .l. Connors . . . actually we felt no different . . . but we were Juniors . . . round- ing the last turn of our high school careers . . . 48 JUNIOR GROUP First How, left to right-Gallach, Davis, Hill, llepman, Lauer, Wnuk. Second Row, left to right-Rubino, Daily, MacLauchlin, Cook, Tenza, Mrs. Bartlett. SENIOR GROUP Seated, left to right-Doleeki, McDonald, Mrs. Bartlett, Shoop, Gilliland. Standing, left to right-Poweska, McLane, Dolby, Applequist, Leslie, Wydro, Paulson. The four class teams are chosen by try-outs from a group of approximately 150 girls. Requirements are: passing grades, athletic ability, sportsmanship. The games are played by a Round Robin Tournament to determine the winner. The .lunior Class topped all others by winning three games and losing none, Seniors were second, Sophomores third, and Freshmen, fourth. QCoaCh- Mrs. Bartlettj. 49 .lfllvnanmff in Action . . . we elected officers early . . . planning a big year . . . made a little cash on the magazine campaign , , , started making plans for the prom . . . added a few gray hairs . . . it was our first year to have an adviser, poor soul . . . I 50 'Dnamatlca we developed our talents in all school activities 51 ,M Sanlon Gallant Delft Take My Penny A , Director-F. L. Lewis Sponsor-Senior Class Warren J. Anna, Adviser GG 93 . . . lost our superintendent to the Arlny . . . also, a new big lioss took over at Senior . . . V52 cvvllffbtenlg Uallcuj HG-host Wantedl' DirectorMF. L. Lewis Sponsor-Student Council John English-Adviser Seated, left to right-Deyoe, McCoy, Spear, Johnson, Kelley, lihoy, Pearson Standing, left to rigl1tfZiegler, Mott, Logan, Womer, Broaden, Mr. Lewis. . . . defeated Franklin twice in football . . . more and more Wal' bonds . . 53 CTi'1QAb'JiC1YL .Society Under the supervision of F. LaMonte Lewis, the Thespian Society was organized this year. Members of the honorary society must pass certain eligi- bility requirements for membership. These young actors set their goal at becoming four-star thespians, the highest honor in this national organization. Both entertaining and helpful meetings were held twice monthly. President ........ ................................. L ee Hanna Vice President ,.... .... J eannie Stoudt Secretary ....... ,........ l iuth Russ Treasurer .......,.....,..................... Mildred Sherman Clerk .... .................................... .l ean McCollum . . . had lots ,n' lots of rlatcs . . .in U. S. History . . . whois this Wluzzy . . . ? 54 Commencement Galax? First Row, left to rightfllflintz, lluss, Sherman, Hanna. Second How, left to right-Heath, Anderson, Dolby, lVlcCollumg Puleo. Third Row, left to right-Murphy, Ludwig, Allebach, Logan. The Barrettsn DireuLor--F. LaM0n Le Lewis . . . wonlen war-workers became common-place . . . oh, those slacks! u0h, Frankie . . . a distinct man-power shortage . . . don't swoon, please . . . 55 cwlalee-u5J and .Stage qoncea A great deal of credit is due these groups for their part in making the dramatic events of Senior successes. It was their duty to make the settings for the plays, put the actors in character , and dress', the sets. The make-up group is advised by Mr. Townley and Mr. Anna. Mr. Townlcy is the adviser for the stage force. . . . Hub Club was organized . . . school spirit was at its peak . . . Student Council adopted a hall guide system . . . we fell short of the district basketball title . . . '40ff we go-i' . . . Arnly Air Corps tests were given at school . . . Seniors enlisted left and right . . . for all of OUR fuming the Prom was a SUCCESS! . . . and we had one more year of school ahead . . . 57 Uolt Oncheatna The 'Pit Orchestra, which is composed of chosen members of the music groups, furnished fine music at the school's dramatic and musical productions. All credit to Mr. Runzo, who has maintained and exceeded previous orchestral standards. President ..... ..... J oe Kiskadden Secretary ..... ..,. M ildred Sherman ORCHESTRA F First Row, left to right-Jetter, Nelson, Barnfield, Sharp, Sherman, Clark Duarte. Second Row, left to right-Roberts, Kay, Ludwig, Young, Mr. Runzo, Baumbach, Barrett, Daily. Third Row, left to right-Payne, Novak, Deyoe, Holtz, Campbell, Rizzone, Hare, Hipwell, Behringer, Applequist. Fourth Row, left to right-Bahr, Taylor, Rodgers, Dolby, Miller, Culp, Jetter, Kennedy, Donley, McCollum. Fifth Row, left to right-Gilliland, Chacona, Kay, Taylor, Yost, Kiskadden, Kofford, Sixth Row, left to right-Lauer, Wenner, Collins, Kelly, Ziegler, Puleo. Wvlanchlngy Clilancll Most of the pep at our football games comes from our marching band. This group is one of the best in this section, and we give them much credit for thelr success. President. I .... ..... l lobert Chacona Secretary ..... .... B etty Bahr ' BAND First Row, left to right-Brumbaugh, Rutherford, English, Jetter, Hagerty, Culp, Perrine. Second Row, left to right-Collins, Moore, Berry, Bell, Lauer, Mr. Runzo, Stormer, Reese, Toy, Snyder, Sampsell. Third Row, left to right-Osenider, Kirkwood, Jerko, Fitch, Stevens, Kohlman, Moyar, Witmer, Yost, Taylor, Chacona, Breaden, Witten. Fourth Row, left to righthDonley, Shafer, Miller, Payne, Clark, Weiford, Barnes, Taylor, Rodgers, McDaniel, Smith, Downing. Fifth Row, left to right-Puleo, Wilson, McSparren, Connelly, Smith, Stewart, Dumpe, Highfield, Dolby, Martone, Mild, Gray, Kofford, Kiskadden. Sixth Row, left to right- Kelly, Wenner, Ziegler, Kimes, Goldberg, Lindsey, Kerr, Culbertson, Bahr. We returned to school . . . September 5, 1944 . . 59 Chonuaea The three choruses, directed by Mr. Mitchell, performed notably in the opera, Christmas Concert and the Spring Concert. The daily chorus period serves as a beginning for every member's goal, the hope of becoming a member of A Cappella. , Wlinth Qnaclla Chonwi First Row, left to right-Sibble, Say, Puleo, Williams, Bennett, Beightol, Apple- quist, Mr. Mitchell, Deyoe, Gray, McCrea, Bieliski, Loebelenz, Whittall, Urey. ' Second Row, left to right-Lewis, Thompson, Trotter, Coogan, Klosinski, Holquist, Collins, Reeves, Bucholz, Pullease, Klinehammer, McDaniels, Townsend, Bruzeski, McFarland, Heath. r Third Row, left to right-Murray, Spence, K. Spence, Downs, Dunlap, Beemis, Henderson, Hardy, Hafer, Rennacker, Mozur, Moore, Oxenham, Lenser, Rembold, McLauchlan, Allison, Dollard. Fourth Row, left to right-Black, Whitehill, Hurst, Meade, Stephens, Toy, Gregory, Griffith, Powell, Hepler, Williams, Pliska, Idzi, Drelick, Shaffer, Hannon. Fifth Row, left to right-Skelly, Lauffer, Arthurs, Speer, Baker, Deeter, Weber, Nelson, Wilson, Hefferman, Brown, Mast, Rennacker, Smith, Austin, Meabon, Rodgers. Sixth Row, left to rightWBurns, Horne, Kerr, Pritchard, Brown, Marshall, Graff, Toy, Peters, Greer, Kindelberger, Anderson, Evans, Sharp, Rankin, Duarte, Moyar, Detar, Lockwood, Ramsey, Russell. Qinlla' Chain' First Row, left toeright-Lange, Dolby, Davis, Phillips, Bahr, Leskoske, Mr. V Mitchell, Shaw, Filson, Hanna, Holden, Baughman. Second Row, left to right-Andrew, Nuhfer, Ames, Cable, Akins, V an Dyke, Rubino, Lee, Frantz, Budesky, George, Cunningham. Third Row, left to right-Pritchard, Hinds, Kerr, Tucker, Stevenson, King, Miller, Roberts, Bernhardt, Strickenberger, Potts, Bixler, Vescoe. Fourth Row, left to right-Conklin, Felmlee, Pritchard, Buday, Berlin, Exley, Stanton, Carothers, Finnefrock, McCoy, Whitten, Aber, Smith, Ward. Fifth Row, left to right-Tarr, Moore, Rodgers, Pearson, Hipwell, Tenza, Roddy, Connelly, Weaver, Fields, Ludwig, Bower, Jetter, Lane, Budzinski, George, Alsbaugh, Kerr. 61 all Calpbuellfa Chain First How, left to right-Rose, Schnepp, Barnfield, Morgan, Tueker, Anderton, Shields, Logan, Mr. Mitchell, Ausel, Kay, Dolby, Jeffrey, McCollum McCutcheon. Second How, left to rightfliobinson, Russ, Bankson Moyar, Gaddess, Strickenberger, Smith, Gilliland, Allebaeh, Heath, Cauvel, Verner, DeArment, Huefner, Hagerty, Krug, Moore. Third How, left to right-Novak, Bankson, Brumbaugh, Adams, Miller, Lenser, Redmond, Latta, Hetrick, Lesh, Kulling, Carson, Alsbaugh, Bieliski, Gegogeine, Tock, Poulson. Fourth Row, left to right-Klos, DeWalt, Aites, Puleo, Evans, Rogers Kahle, Montana, MeCrea, Johnson, Shaw, Mott, McDaniel, Master, Embleton, McGillicuddy, Graff, Heath. Fifth How, left to right-Bielenberg, Reining, Holtz, Kerr, Taylor, Bradford, Gallagher, Parker, Shafer, Ausel, MeCash, Wood, Parker, Cook, Smith, Rybak, Hookins, Urey, Johnson, Gardner, Clark. ' 5 9 A Cappella choir, ultimate goal of all students in the music groups, has Won the merited praises of both school and the general public. They have earned the undying admiration of all Oil City as a result of their appearances here and in the various civic organizations and clubs, and much credit goes to Mr. Mitchell for his untiring efforts to lead them to still greater heights. President ..... ..... G aylc Parker Secretary ..... ..... l luth Robinson Librarian ..... .... H arry Hetrick . . . it had been a good summerAwe had worked and played . . . got tan and rugged looking . . . but we fervently welcomed our Hre- tornairew to Senior. ' 62 is D 5 2 2.2235 my ' 51391 'Ya 5 gg M , -411 .Swing dilanclllx Uiomth Swing Uflancq First Row, left to rightAEnglish, Graham, Hagerty, Mr. llunzo, Kerr. Second Row, left to right-Breaden, Chacona, Rodgers, liofford, Kiskaddon, Ziegler, Puleo. The Boys, Swing Band is made up of the best male musicians from the music department. We can thank them for all the peppy music at our basket- ball games, and they contribute much to our yearly Broadcast. qinllh .Swing Uflandl First Row, left to right-Culp, Miller, Hagerty, Mr. liunzo, McCollum. Second Row, left to rightwWitmer, Taylor, Toy, Lauer, Bahr. Oil City shines in originality with its girls' swing band. Their fine music can be only the result of patient practice and talent, and they offer the boys some keen competition. Both groups are under the leadership of Philip llunzo. Our eagerness somewhat dwindles . . . as we settle into the old familiar routine . . . classrooms . . . assignments . . . aetivities . . . Faces, faces, faces . . . look, a Freshman . . . Did we act like that? . . . 64 cllvlulalc Cllulv Counclf For the first time in its history the Music- Club Council presented eaeh departing Senior, who had been active in the music' department, with a pin as a reward for his work. This group composed of the offic-ers and directors of the various music- groups in the high sehool. Its purpose is to act as a coordinator between the music' units. President. . . ............. .loo Kiskadden Secretary, . . .........,.. Mildred Sherman Advisers .... .... lX lr. liunzo and Mr. Mitchell First How, left to right4liodgers, Taylor, liislxaddon, Sherman, Barnfield, Second lion, left to righllAYeseoe, Mr. liunzo, Bahr, Osenider, Robin- son, Tucker, Mr. Mitchell. Third liow, left to rightfHagerty, Parker, Townsend, Melfarland, Chacona. . . . triangles . . . right triangles, obtuse triangles, love triangles . . and on and on . . . , 65 Gill Can Stott Editor-in-chief ..... ..... J aok Greenawalt Assistant Editor. . . ..... Nancy Rose Junior Editor ............, ..... H arry Hetriek Sophomore Representative ..... ...,............ R ay Schoch Literary Co-editors ........ .... L ouisa Urey, Frank Swacha Co-business Managers ...... ..... J oan Cavanaugh, Lee Hanna Art Editors ........... .... V irginia Kifer, Vivienne Kifer LITERARY STAFF Seniors-Barbara Daily, Ruth Robinson, Carol Ann Watts, Dave Pearson, Keretta Wagner, Terry MeQuoWn, Ray Karns, Bill Anderton, Dick Stoughton, Ruth Russ, Richard Fleisohmann., Juniors-Dean Grazier, Ruth Tucker, Pat Lee, Ted Jackson, Sophomores-Pat English. BUSINESS STAFF Seniors-Jean McCollum, Mary Jean Leslie, Betty Bahr, Betty Krug, Doris Hall, Fred Mild, Joan Dolby, Ann Sharp, Bill McCash, Robert Logan, John Gavin, Carl Puleo, Mary King. J uniors-Dick Anderton, Richard Cook, Jane McFadden, Brayton Rodgers, Sally Gallagher. Sophomore-Rhea Filson. ART STAFF George Teeter, Ruth Robinson, Connie Stoughton, Photographers- Robert Logan, Cmanagerj, John Gavin, Virginia Jeffrey, and Mary Jane Weaver. Senior High News RepresentativeHJeannie Stoudt. 66 6dlitoniaQ Ufloandl ot Clgaanlvoolfz It was the duty of the Editorial Board to supervise the Work of their various groups. Under the new arrangement, each department of the Annual had a head who was responsible to the editor-in-ohief and his assistant. The editorial board also helped to train the Junior Editor and Sophomore representa- tivebwho in their respective Senior years may be a great aid in preparing the Oil an. EDITORIAL BOARD Editor-in-chief ........................,...... John Greenawalt Assistant Editor ........ ................... N ancy Rose Co-business Managers ..... .... J oan Cavanaugh, Lee Hanna Literary Editors ........ ..... L ouisa Urey, Frank Swaoha Art Editors ...........,.......... Vivienne Kifer, Virginia Kifer Photography Editor ..........................,.. Robert Logan Senior Hi News Representative .... .... J eannie Stoudt Junior Editor ..... .............. . . .Harry Hetriek' Sophomore Representative ...... ...... R ay Schooh Faculty Adviser ........... .... W arren J. Anna . . . Blue and White . . . hold that line . . . class officers wget on the balln . . . 67 Clzluainolm .Stott Ads, ads anil more ails! Big 'uns or little ,unsl .lust ask our poppy business staff, wlncll is responslblo for the fine management of the subscriptions and the advertising for our Annual. P CO-BUSINESS MANAGERS Joan CiiV2'lIl2'lllgll Lee Hanna fltenanlff Staff Overcoming the obstacles always present in the writing of a yearbook was the main accomplishment of this group for tl1e past year. After terrific months of worrying about an original approach for the 'l.945 OIL CAN, the hard working editors and staff can now relax with a job well done. CO-LITERARY EDITORS A 4 Louisa M. Urey Frank Swacha . . daydreaming in studyhall . . . quiet, please.-. 69 p Student Counclll First How, left to rightmlfields, Miller, Nelson, Hollingsworth, English, Preinsel, Kern, Amsdell, Allebach, Pearson. Second Row, left to right+Mr. English, Toy, Stormer, Motter, Dollard, Hetrick, Bepman, Wilt, Myers, Bankson, Lynch. Third Row, left to right-Ausel, Martin, Shaw, Hege- dus, Miller, Weaver, Kresinski, Barnes. The Student Council, under Whose leadership the student body is governed, has completed another successful year. Among its many activities, the council sponsored a Thanksgiving dance, inaugurated a safety program for the high school, took charge of the sale of play tickets and ushered for the various school events. Other accomplishments for the council have been the buying of books monthly for the library and sponsoring the money drives for the various charity organizations of the city. They also completed their most successful year in the profits made at the football and basketball games. The effort and accomplishments displayed by this group are Worthy of much praise, and a great deal of credit should go to Mr. English, the council adviser, for the interest he has taken in this group. President .......................,........,.... Robert Heinsel Acting President .... . . .Harry Hetrick Secretary ......... ..... J ean Miller Treasurer ..... ...... W illiam Kern Adviser ..... .... J ohn E. English . . . football banquet . . . V. HO. initiation . . 70 Quiclance Counclll The council, made up of one member elected from each home room, met with Mr. English to discuss school and student problems, morning assemblies, and general information needed to run the guidance program. First How, left to right-McLachlan, Greer, Barnes, Leslie, Polm, Anderson, Gregory, Burns, Stuart. Second Row, left to right-Wnuk, Jackson, Puleo, Langford, English, Parker, Mild, Mr. English. Third How, left to right-Jasiota, Driscoll, Henlen, Straub, Dehner, Collins, Cieplechowicz, Weaxfei'. Ah, me . . . nothing but trouble, trouble, trouble . . 71 -'M Councill First Row, left to right-Mr. Townsend, Hanna, Mr. DeFrance. Second Bow left to right-Hetrick, Mott, Kiskadden, Greenawalt. THE HI-Y GROUPS To teach young men the finer qualities of life and a way to live peacefully among our neighbors is the chief aim of the Hi-Y. If the results of these clubs continue in the future as they have in the past, its success is assured. Besides regular weekly meetings, these clubs also held various theater parties, and in teresting boy and girl forums. President ..... Vice President Secretary .,... Treasurer ..... Adviser ..... President ..... Vice President .... Secretary ....... Treasurer .... Adviser ...,. GABRESKI HI-Y President ..... .... A SENIOR HI-Y Secretary ..... ...,........ Adviser ...., 73 Joe Kiskadden . . . .Terry McQuoWn . . . . . .Bob Chacona Don Smider Dana Pringle EISENHOWER HI-Y HN...-.'...-Cliarles Dawson Harry Hetrick Bill Kern i l. i. I. V. U. i. Nelson Warren Anna .Hallsay Allison ......,TomCook . . . .John Connors c?7'lE,AhYYLC7118 Gnd 3LLYl.bEY'L Cgulih Tuesday is stamp and bond day . . . d0n,t nlention snow . . . basket ball dances begin . . . uBattle of Music . . . 74 Qinll CRa1.xenuz-:A This year, as in the past, the Girl Reserve groups were divided into two clubs. The .lunsen Club composed of Senior and Junior girls, and the Freshmore Club composed of Sophomore and Freshman girls. At their weekly meetings the girls under various leaders discuss present day problems. Red Cross work, parties, banquets, and teas filled the social program for the year. . A JUNSEN . First Row, left to right-Johnson, Bankson, Hagerty, Novak. Second Row, left to right-lVleElhattan, Reining, Sherman. F RESHMORE First Row, left to right-Budesky, lVleFall, Welms, Curran, Ayres, Colvenbach, Second Bow, left to right-Filson, Kindelberger, Kimes, Bower, Bahr, Kerr, Diehl. Third Bow, left to right-Hanna, Pearson, Stephens, Holquist, Eagan, Leskoske. , New library desk . . . Accentuate the Positive . . . MII Trovatorew . . split four games with Franklin . . . 75 Etlqjuette Cilub To carry out the purpose of a better school through better manners, this year the members of the Etiquette Club made posters, conducted a personality quiz and wrote weekly hints in the school paper. Under the guidance of Miss Evelyn Moyar, adviser, the girls discussed different phases of social activities and personal charm at theirmonthly meetings. I President ..... ....................., ..... I 1 uth Russ Vice President ..... .... S usan McLane A Secretary ....... .... R uth Gardner Treasurer .... .... X lirginia Russell First Row, left to right'DeArment, Russ, Gardner, Driscoll, Hanna, Budeski, Fields, Tamburine, Bower, Ross, MacDonald, Jones, Russell. Second Row, left to right-Miss Evelyn Moyar, Konen, Berlin, Conklin, Hipwell, Exley, Diebold, Bower, Benton, Sawatsky, Lane, Meals, Smith, Smith. Third Row, left to right-Slater, Hinds, Quattro, Giltinan, Moore, Flock- erzy, Moore, Smith, Collins, Abbott, Embleton, Colvenbach, McDaniels. Fourth Row, left to right4Bahr, Leskoske, Hinslae, Ross, Davis, Hopwood, Donley, Arras, Smith, Connelly, Colvenbach, Graff, Croft. Chemilitnlj Cfub All the casualties of the students of the past year did not result from service performed on the gridiron or court. No, Sir! Some developed in the chemistry room over a slip in an experiment. But all in all, the experience gained by the members in this course should prove worthwhile in our coming post war world. c President ....... ..,... R obert Logan Vice President ..... ..... M ary Jean Leslie Secretary ........ ........ N ancy Rose Treasurer .... .... H elen Hagerty Adviser .... . . .J . J. Connors First Row, left to right'-Daily, Sherman, Urey, Hagerty, Huefner, McCollum Novak, Taylor, MacDonald, Nelson, Rose, Smith. Second Row, left to right-Payne, Reinsel, Karns, Leslie, Dolby, J effrey, Emanuele, Gilliland, Hall, Robinson, Gardner, Abbot, Cavanaugh, Mr. Connors. Third Row, left to right-Nieklin, Stoughton, Rodgers, Ludwig, McCash, Duink, Gavin, Gray, Pearson, Kennedy, Mintz, Hanna, Logan, Parker. The Voicew still sends 'em . . . new electric diswasher in cafeteria . . 77 s CUZ and qua .Shop cwlachlne .Shop Cflulv What,s that aroma? . . . Chemistry Blowouts . . . greetings . . . dit dit-da-dit . . . 78 Gill and qua .Shop h The boys of the Oil and Gas Shop, under Mr. Bucl4ham's direction, have received practical work in the ,lines of oil field production, transportation and refinery practices, welding and steam fitting, sheet and metal trade. This course affords a better understanding of oil field production and process of oil refining. The boys graduating from this course are ready and able to take their place in oil and gas industries. Mr. Buckham .... ......,........ A dviser Donald Motter ..... ..... P roduction Manager Brayton Rodgers ..... ................. G eologist Alvin Remaley ..... .... D filling Superintendent Robert McClellan .... ..... Pi efinery Engineer Charles McClintock .... ....... C hief Chemist Harold Meabon ....... .... M aster Mechanic cwlachine Shop Club The boys in the Machine Shop Club, receiving valuable training on the various machines in the shop, gained experience which will be of great value to them after their graduation. ' Advisers .,.. .... M r. Mills, Mr. Hill . . . hard at work on the '4Can', . 79 Jluto cwlachina Cllulrf The boys of the auto shop, under the guidance of Mr. Faust, have received training in automobile mechanism and theory, and have had actual experience in repair operations on cars and trucks. These fellows also had some instruction in the field of aeronautics. President ....,. ..... J ack Grazier Vice President .... ....... J oe Malys Secretary ..... .... D uane Pfendler 1 Treasurer ..... . . .T ,Joe Hollabaugh Shakespeare . . . to he or' not to be . . . that is the question . . . League Champs? . . . zombie stalks Senior halls . . . '4Ghost Wanted 81 'Wlath Cllubr A The members of this club are the first year grade AU algebra students. This newly organized club is under the direction of Miss Mackenzie. Adviser ................... ............. M iss Helen Mackenzie President ...,...... ........... J ane Kerr Vice President ..... . . ..... Julie Skelly Secretary-Treasurer .,... .... B everly Peters First Row, left to rightfSmith, Gray, Kerr, Taylor, Mozur, Strycher, Miss Mackenzie. Second Row, left to right-Skelly, Burns, Kindelberger, Austin, Lenser, Lauffer, Lewis. Third How, left to right-Hafer, Galysh, Enos, Knight, Talley, Peters. .fatln Cllulv The Latin Club, meeting every month with its fine adviser, Miss Jean Mackenzie, helps the members to gain a better understanding of the value of the Latin language today. Magister ....... by .... ,,.. J erry Hagerty Magister-secundus .... ......... L ouisa Urey Scriptor ............ .... li Ilizabeth Masters Quaestor ,...,.... ...... D orothy Kerr First Row, left to rightelinglish, Rodgers, Jones, McGrath, Pearson, McLaugh- lin, Pleger, Miss Jean Mackenzie. Second Row, left to right-Barrett, Filson, Gallagher, Urey, Roos, Murphy, Wilson, Klos. Third Plow, left to right-Bhoydes, Hagerty, Stewart, McFadden, Levi, Hollenbaugh, Sharp, Ward. A Home Eco nomlch Cllub Under the direction of Mrs. Polansky and Miss Templeton, the girls learned the fine points of home making. Besides the instructive session, several parties were sponsored by the group. First How, left to right-Miss Templeton, Barlog, Lutz, DeArrnent, Matha, Yez, Hanna, Mrs. Polansky. Second Row, left to right'-Martyna, May, Poweska, Ziemba, Erwin, Glaz, Malcolmson. Third Row, left to right- Powers, Aites, Rodgers, Cann, Felmlee, Nick, Archible, Truscott. . . . Look at the birdie, please . . . sines, cosines . . . art signs for library and studyhall . . . 83 .fllsnanlf Staff, This group of girls, under the excellent leadership of Miss Eleanor Hoy, are perhaps one of the most deserving, but least commended groups in the high school. These girls are recommended by their freshmen teachers because of their high scholastic standing and ability for the purpose of learning library methods. Among their many duties are changing books, preparing new magzaines and books for use, filing cards for the card catalog, and numerous other duties. Adviser ............ ........................ ly liss Eleanor Hoy First Row, left to right-Masters, Kerr, Filson, Kern, Budisky, Sheffler, Rodgers, English, Kaweski. Second Row, left to right-Virgina Kifer, Vivienne Kifer, Russ, Stoudt, Hall, Cook, Stahl. Third Row, left to right-Mills, Daily, Sherman, Hagerty, Abbot, Jctter, Murphy. Stamp andl Clilondl This group, under the direction of Miss Mackenzie, is made up of one representative from each home room. The purpose is to build up the quota of the school which helps in the buying of different types of war equipment. May the work of this group help in bringing VICTORY nearer. First Plow, left to right-Shafer 122, Reed 304, Deulott 224, Johnson 224, George 4-24, Battin 443. Second Row, left to right-Deeter 305, Aber 422, Meabon-Oil and Gas, 422 Wolf, Johnson 343, McCash 211, Kerr 123, Deyoe 106, Budesky 424, Taylor 223. Third Row, left to right-Motter 103, Miller-Machine, Fleischman 105, Smider 322, Buckham 341, Birsa 204, Emanuel 113. Spring . . . a young man,s heart turns to . . . ba-wing! . . 85 V Oiuainem .Staff Without a business staff aanewspaper is useless, but with one we can readily see it is everything. So, we find upon the strength of the A-1 ad sales- men, the Senior Hi News has lived to give our high school an admirable name in the business world. To Larry Goldberg, manager, and to Miss Hoy, adviser goes much praise for the success. Manager ..,. e ,.... Larry Goldberg Adviser ..,. , ..... Miss Eleanor Hoy fit:-znanlj Statt Here's the group of students always buzzing around school and asking individuals all sorts of questions in order to beat ol' father time to that Wed- nesday night deadline. Under the supervision of editor Jeannie Stoudt and Miss Nelson, adviser, the News has accomplished a great feat in going to press every two weeks without miss. Editor ..,.... ..... J eannie Stoudt News Editor ..,.....,. .... ll flary Jane Wnuk Editorial Page Editor .... ...,.........,........ L ouisa Urey Sports Editors ...... . .... Terry McQuown, Dick Thompson Girls Sports Editor ..... .,.........,...... R uth Bielenberg Art Editor ........... ..... Y firginia Stormer Adviser ..,.. ..... M argaret Nelson . . . and during the commencement play Wfhe Barrettsu we keep think- ing, 01'-? ' 87' Santana W-iii Cpaqe 89 - - Jlflma cwlaten 90 M .Sigma Kappa Sigma 97 - Cpnom Kina and .Queen qootl-:a1Ul Queen 98 Euenta andl Otticena 100 - Qnadluatlnq Senlon Otticena 101 . - .Senlom 124 - - .Senlon Sulpenllatloea 125 - .Semen Jlctluitlea '6It,s all over, and we pace the world alone with a sheet of parchment, our passport to the future . . . ss p ALVXA VIATER JM? gvrijqi - O PM-m Hpygbwf. nu ou- 1.117 Huff sweat. we I-WE S0 4 . iM Eg1Mm or ,UR No-DLC M.-M MA-fm LET ...R ms-ss J ibel is iiwfiiblfj o 6 K I 'Wiz : 1. HF! iii HH Af s na s ww 91? .Sigma Kappa .Sigma The Sigma Kappa Sigma, an honorary Senior Key Society, has been formed under the auspices of the 1935 Gil Canf' Membership in the society is restricted to the three Senior men and three Senior women who best represent their class. The members are selected by the Senior Class in a secret ballot, the qualifications under consideration being: Scholastic standing, 8Xll'H-C'l1l'I'lCl1l3l' activities, friendliness, leadership, and helpfulnessf' Taken from-1935 OIL CAN 90 BARBARA ADAILY II I I 91 JOHN W. GREENAWALT ll I 92 ll l :lc NANCY ROSE 93 DAVID PEARSON z z gill 94 ll l JI: RUTH RUSS 95- V I. i. ' RICHARD STOUGHTON ll l I 96 fPnom 'King and .Queen Ruth Bielenberg Ray Karns qootlaau Queen Ruth Bielenberg 97 gm-znta andl Gtticena President ..... Vice-President .... Secre La ry ...... Treasurer. . Adviser. . Dave Pearson Barbara Daily Vivienne Kifer Thomas Hahn ot the CQQAA ot 1945 union aan NOMINATING COMMITTEE CLASS OFFICERS PHO M COMMITTEE Jada G reenawalt, Chairman . . .Dave Pearson . . . . .Barbara Daily . . , . .Vivienne Kifer . . . . . . .Thomas Hahn .....Mr. Warren J. Anna Edward Vandenberg Nancy Hose Ruth Bielenberg Donald Smider MAGAZINE CAMPAIGN COMMITTEE Co-Chairmen . . .... Mary King, Lee Hanna All Sm-hool Play. .. . . . Friday, the l3lh .lunior Prom ..,.. Herbie Johnson 98 President ....... V ice-President .... Secretary. . . . . Treasurer ..... Santan aan CLASS OFFICERS Adviser ................... Student Council President ..... Office Girl ............... . -Q- Oil Can Editor .....,.......... .... . . . .Edward Vandenberg . . . . . ,Vivienne Kifer . . . . . . Jeannie Stoudt . . . . . . .Joseph Simpson . . . .Mr. Warren J. Anna . , . . . .Robert Reinsel . , . . . Charlotte Ryczko .. . . . . . . .John Greenawalt Oil Can Co-Business Managers .... .... J oan Cavanaugh, Lee Hanna Cheerleaders ........... . ...................... Laura Myers, Ruth Bielenberg John Greenawalt Virginia Kifer Ray Karns Nancy Rose William Anderton Robert Buchna Barbara Daily ANNUAL COMMITTEE Richard Stoughton Dave Pearson Frank Swacha Barbara Daily RING AND PIN COMMITTEE Mary J asiota Dave Pearson Joan Dolby Mary Jean Leslie CHRISTMAS CARD COMMITTEE Mary King, Chairman Anna Marie Emanuelle Keretta Wagner Ruth Bielenberg Donald Smider Donald Motter John Hegedus Ray Karns James Shields ACTIVITIES Senior Class Play ..... .............. . . Don't Take My Pennyi' Mystery Play ..... ........ ' 'Ghost Wanted Broadcast ....,. ........... M rs. Bartlett Baccalaureate .... . . .Dr. A. B. McCormick Prom ................. . . .Roger Carle's Orchestra Commencement Play ..... ....,.. 5 'The Barrettsw Opera .........,...... .... ' LII Trovatore Yearbook Story .... .... . lohn Greenawalt 9,9 .Sz-:mon Ottieenh y VAN DEN BERG, EDWARD N andy Class president, '44 - ,45. Okay, girls, get ready. One, two, three, swo-0-on! When a build and personality like that come along, plus athletic ability, it's not a great: surprise to find him elected senior class president. STOUDT, JEANNIE LOU 'I'enny Senior class secretary. . Our senior class secretary, .Ieannie is also editor-in- chief of the SENIOR HI NEWS. Friendly. good-natured, smooth dancer, definitely a swell pal . . . Need we say more. KIFER, VIRGINIA LEE Kife Senior class vice-president. Here's one half of Senior's greatest mystery: Which Kife is itil This girl with the long, luscious tresses has been for two years a very capable class officer. Ginny ranks high in Senior's list of best-dressed girls. SIMPSON, JOSEPH ...Ines Senior class treasurer. This is the bum who rakes in the sheckles-the Morgenthau of Senior, as it were. Seriously, though, .Ioe's our idea of one grand fellow. REINSEL, ROBERT Rube Student Council president. Here's Big Rube -protege of Big Joe . A varsity gridder, council president, general good fella, Bob's got only one weaknessfLes. GREENAWALT, JACK Grecnie Editor-in-chief of the SgOil Canw. The class of '45 owes a lot to UGreenie for his activities on the gridiron and hardwood and for his splendid job as Oil Can editor. .Iackie', plans to combine his charm and cute talk with a gob uniform. Look out, wimmin! ROSE, NANCY Nance', Assistant Oil Cann editor. Nance's pretty hair and super clothes are the envy of many a seniorette. She's cheerful, friendly, full of pep, and plans to be a social worker. GG PEARSON, DAVID Dave Class president ,4-3 - ,441-. ' Dave, our junior class president and former athlete of Franklin, is one of the indispensable members of the football and basketball teams. Enlistment in the Navy is his future plan. ABBOTT, CHARLOTTE Char , To see Char whizzing by at the roller rink, you'd never guess her ambition is to become a serious laboratory tPCl1IllC13I1. Chemistry, of course, 1S her pet field. ADAMS, ,IEANNE ' Brown-eyed .lean has aspirations towards becoming a nurse. She's one of our many knit-wits , and we do mean KNIT AITES, BETTY Bets Bet's chief interest is roller skating. Say, could that collection of servicemen's pictures bespeak itself of a fickle heart? ALLEBACII, THEODORE Ollie What with Ollie's talents in dramatios, and music, it's hard to imagine him in his chosen profession of under- taking. Dare we wish him success? ALSBAUGII, JEAN Weary Since .lean's future lies in nursing, she'll probably have little use for her collection of novelty pins. ls there any real meaning behind that nickname- Weary9 AMES, CHARLES Just give sports-minded Charles a red cap, a hunter's license, and a good ol' shotgun, and he's in his glory. He plans to become a mechanic after the war's over. ANDERSON, BETTY LOU Betts llere's the gal who's been around-New York, Pittsburgh, and finally little old Oil City. Maybe it'll surprise you to learn that Betts enjoys a quiet type of recreation like piano-playing. ANDERTON, WILLIAM A Li'l Willy h Willie is the lad who's so adept at the jewelry trade and blonde cheerleaders. He plans to take up medicine in the distant future. Meanwhile, his friendliness will win him many close buddies when he enters the Army. ANDREWS, ELLEN MEIN Ely is a quiet, likeable girl. who can hold her own on roller skates. Here's hoping she-'ll make as good a kinder- garten teacher. ANDREWS, JOAN NIAXINE lo VVhen not at the roller rink. Jo can be found at home reading a book. Her extreme industry undoubtedly accounts for her good marks, 101 APPLEQUIST, KATHRYN HELEN 6'Kathy', Feature Kathy untangling Shakespeare for another generation. Dependable and aspiring to succeed, she will do the trick. ' AUSEL, PAUL HONIER uColossal The Colossal Ausel is tall with dark, wavy hair. When he is not hossing the stage force, he can be found tinkering under a car. BAHR, BETTY HBH B ranks supreme among the 'Lfashion-plates of Senior. Though slappin'the bass in band, orchestra and girls' swing band is one of her many accomplishments, B has definite plans to he a nurse. BALOT, CECILIA LOUISE Bullet Bullet,' is an ardent bike rider and autograph collector. 'Very dependable, she will be indispensable as a clerk in some large department store. BANKSON, ARDELLE E. ' Ardelle's friendly disposition and attractive personality will assist her immensely in attaining her goal as a success- ful secretary. She is one of the vicinity's woman drivers. BEHRINCER, IWARGARET ANN Peggy Ann Well, in a few years we'll be seeing Peggy in specs with a ruler in her hand, lording over some poor un- fortunate. Good luck, Peggy! BENNETT, ROBERT nB0bn In the middle of the night, roams Bob, pursuing his hobby of midnight shows. A potential auto mechanic, he spends his leisure time roller skating huntin and . . .. . , g fishing. ' BIELENBERG, RUTH ..Buggy,, A pleasing personality, nice smile, faithful cheerleader -put them all together-+you get Buggy. BIELISKI, LEONA Lena Leona's ability to make a keyboard give doesn't leave much to he desired She has fond hopes of brivhtenin V ' i ' ra g some private office with her cheery smile. BILLS, CECAL REATRIX Rusty Rusty has quite a hobby-collecting photographs and writing poems. After graduation she plans to settle down on that cattle farm in Minnesota. BLAU SER, OLIVER ALFRED New e The army will have Olley very shortly, but at present he is interested in radio. Good luck, Olley! BOWER, HELEN JOAN Joan is that tall gal often seen in Senior's halls. She's invariably found with her best friend, Jean. BRADFORD, DOROTHY HDOU, , 'Dot's another of our students with considerable music Sblllty. She hopes to brighten some business office. BREWSTER, NORMA 'ButCh', If you see a blue streak some day, that will be Butch driving CPD the family car. Her job at Brody's keeps her busy and later she plans to be a secretary. BRITT, IVAN LEROY Hporkyn Quiet, serious Ivan divides his time between O.C.H.S. and the Oil Well Supply. He even finds time to read a few books. ' BRUNO, FRANCES ,IANE Frannie 'LFrannie, an attractive brunette, is a well-liked seniorite. Shc's a good sport and promotes fun wherever she goes. ' BRZUZ, LOTTIE nsparkyu b Small, sweet, and lively describe Sparky to a UT . She loves to sing and desires some day to be one of those women in white. BUCHNA, ROBERT CHARLES 6 Bob! 3 Witty, happy-go-lucky, critical, neat dresser-that's all we need to know about Bob. Seriously, though, heis one swell guy. BUCHNA, WILLARD Bill Bill's easy-going manner and shy humor make him good company both in class and outside of school. For the duration his chief interest is the Navy. BUDZINSKI, WANDA Wanda loves to sing but shc'also participates in girls' sports. Her plans for the future include business school. BURT, RICHARD K'Gert Because Gert has been kept busy in the vocational department, we haven't seen him around, but we are sure he is as nlce as his friends say he is. CAM PBELL, HELEN ..Red,, . 'KRcd', is short, friendly, and an enthusiastic bicycle rlder. Many a patient will be made well quickly. when Helen achieves her ambition to become a nurse. CARLSON, JOAN ...ION Jo, shy, but friendly, is rather undecided about her future. She loves to write letters, and she's strictly an out-of-doors girl. CARPENTER, BOB Ncarp!! There is never a dull moment in the 6th period English class with Carp in it! Besides being a source of much amusement to his friends, he is also interested in music and building airplanes. Senior lost Bob to the Army in January. CARSON, VIRGINIA .linny .linny has those big brown eyes everyone wishes for. She loves to bowl and will enter the business world upon graduation. CAVANAUGH, JOAN ..J0,, .lo's pleasing personality wins everyone. Getting to college to prepare for business administration is her chief interest. As writing letters is her hobby, she consumes quite a bit of paper' in a week. CHACONA, ROBERT Chacona CHAcona Caecent on the first syllableb toots a mean trumpet in practically all music activities. He also makes a striking Frenchman. CIEPLPICIIOWICZ, HENRY 'LHank,' Hank who is OUR quiet member of the vocational department is one of those individuals who has scores oi boy friends, but a unix to the girls. CLARK, IIELEN ROSE 'iClarkie The pretty little miss is fond of all sports, but es- pecially roller skating. After graduation she plans to be a secretary. CZLONKA, ,IESSIE ' This happy-go-lucky girl, aiming at a business careeri plans to be a stenographer. When she isn't collecting post cards, you will probably find her dancing. 104 DAILY, BARBARA ANN L'Queenie ' Queenie is one of Seniors most popular characters, and after meeting her, you'll know why. Her constant grin and witty remarks will keep you smiling with her. DeARMENT, ERLA MAE Herk Herk, who has the type of personality everyone wants, is envied by all her friends. At present her chief interest is skating. After graduation she plans to work in an office. DILLE, MYRTLE DELYTE uMyrt,, Myrt , pretty and quiet, with her neat blond appear- ance, is envied by all her friends. At present her chief interest is skating. After graduation she plans to work in an office. DOLBY, MARIAN JOAN Slatsie Tall, neat and good-looking. Slatsie's deep voice has won her the honor of being a member of the girl's quartet. Nursing will probably take up most of her time after graduation. DOLECKI, HELEN Piney Piney plans to make some lucky person a good secre- tary, a job which we know she can do. Her hobby is collecting pictures. DRISCOLL, PATRICIA LbPat!9 i Pat is really on the beam when it comes to dramatics as can be seen by the many plays she has been in. After graduation she plans to take up nursing. DUGRENIER, BETTY Bette , Because Bette likes to travel she will probably be seen. She spends most of her spare time collecting post cards and reading. DUINK, JOHN .lohnnie is one of Senior's math sharks and keeps'the solid class in a continual uproar with his hilarious remarks. He plans to attend college. UUNKLE, NORRIAN 'iNorm ' Tall. dark, handsome t'Norm is not seen too often in the halls of Senior due to his taking the vocational course. Strange as it may seem, women seem to hold little interest for him. Heavens! EISMONT, ANTIION Y Geezie The Navy will get a swell fella when they get i'Geezie.j' Ile's one of those tall, dark men from the shop and is interested in photography and sports. V 105 ELAHI, RUTH Ruthie A Ruthie is a swell kid and everyone's friend. We hear she makes those cute little lapel pins herself. sThe Senior Class wishes her luck in anything she chooses to take up in the future. EMANUELE, ANNA MARIE Plunk Even though Plunk is shy, she is very amiable once you get to know her. She is another one of our senior girls who plans to take up nursing after graduation. EMBLETON, DOROTHY JANE 551306, Dot has no plans for the future, butgher present in- terests are roller skating and ice skating. i Her hobby is collecting glass dogs. FARLEY, WILLIAM 4aBilly1 ' Between automobiles and girls, Bill is usually in quite a dither. He's friendly and doesn't hesitate to give his opinions. Mechanical engineering is his choice for the future. FLEISCHMANN, RICHARD , Dutch Dutch with his wavy, blond hair is an all around good guy. He enlisted in the Army Air Corp Reserves last August, thus showing where his interest lies. FLICKNER, DORIS A ccKidsy , Short and cute Kid has no plans for the future but her chief interest at the present is music. The entire Senior Class wishes her luck in her post graduate years. FORBES, ARVID c:Redv1 Red, one of the town's pool sharks, hails from Plumer. He's rather small, but has a fine sense of humor. FRY, GLADYS Gladys, a seniorite miniature, has that envied knack of making friends. This neat little dresser also is quite an athlete. Her future is already decided by that ringg third finger, left hand. GADDESS, BETTY Betty's congenial manner and pleasing smile have won her many friends at Senior. This little lass is right at home on the roller rink. GALLOWAY, MARY Mary is a short and friendly member of our Senior Class. You will find her always ready to lend a helpful hand. We are sure she will be successful in any walk ol' life she chooses. 106 GARDNER, .RUTH Gardie Gardie possesses a nice disposition. She is very in- terested in music and chemistry. Ruth plans to go in training as a nurse after graduation, a vocation in which she will succeed. GAVIN, JOHN ' 'Winker John is an all-round and everyone's pal. Whether he goes to college or into the service, he's sure to make a success. GEGOCEINE, PHYLLIS alphilvy Phil is a quiet, studious gal. Her chief interest is in music. Without her, A Cappella would never be the same. GEORGE, ROBERT CLAIR ..BOb,, . Bob could certainly be classed as an out-of-doorman, for his chief interests are hunting and fishing. He has a likeable personality and gets along with most everyone. GESING, BETTY JEAN HB. J. Betty, a petite young miss, is well-liked for her quiet manner and sweet personality. , ' GILLILAND, JOAN .flown This girl with the beautiful chestnut brown hair is Jo. Ilere is that pleasant' soprano prominent in the girls' quartette and outstanding in all ofthe musical activities. GOODMAN, CLEON IRWIN ' 'Clem Handsome Clem , with the pleasing smile, has a dual interest, hunting and fishing. After graduation he will become a potential member of Uncle Sam's forces. GRAFF, HELEN ELIZABETH Murph Known to her friends as Murph, Helen's chief in- terest is musie. Her ready- wit and pleasant smile will carry her far in any occasion. GRAY, .IOHN H. A 5 6'Glory , whose chief hobby is at present a certain -girl, plans to go to college. Mainly interested in sports and a dependable player, he was a letter winner. ' GRAZIER, JACK uBaldyn Baldy is one of the main stays of the Senior Auto Mechanic shop. Quiet-but when started, watch out for Grazier. G UNDERMAN, MURI EL f'Murn Quiet Mum shines when it comes to art. Senior's loss will be Carnegie Teelfs gain next year. HAGERTY, JERR Y' ..Hag,, . Hag,' is one of the prominent members of the Swing Band and he can really play the sax. With that swell personality he ought to be as well known at college upon graduation. , HAGERTY, IIELEN Gert Quiet and friendly-that describes Gert, A mem- ber of the Girls' Swing Band, she really plays a sweet note on the sax. We're sure she will succeed in any voca- tion she decides to,take up. HAHN, THOMAS nT0m,, Do you know the true cause of Mr. Englislfs graying temples? Those striving slaves of Trig, have the very firm conviction that it could be Tom! On the serious side though, Tom has contributed generously to the success of many Senior activities. HALL, DORIS ANN Dorrie' ' Dorrie's winning smile and neat appearance has won her many friends here at Senior. Her hobbies are collect- ing records and dancing. She plans to attend college after graduation. HAMILTON, HARRY Henky Hanky, quiet and reserved, is very much interested in the complexities of the machine. He plans to work in a machine shop after leaving school. HANNA, LEE EDDY Flash! Dash! There goes Hanna rushing from' one activity to another. His dramatic ability has made him known throughout the town. For a more tangible example of his efforts take a gander at the ads in our worthy book. HANNA, ARDELLA Ardella, our Home Economics president, really stirs up the dishes. Some lucky man will have a very happy future. HARPER, JAMES Uncle Jim ' Jim has in one year proved himself a very versatile guy, his accomplishments ranging from farming to serious oratory. However, he intends to make the former his life's work and save his oratory and poetry for his more classical moments. HART, MARTINA Marty lf you hear a line of chatter and see a brilliant smile in your wanderings, you can feel reasonably certain that you have seen Marty. 108 HAUPT, DORIS A Hailing from President, Doris is a conscientious worker and a real pal. HEATH, JOAN Joan is one of those people, who, while quiet on the surface. IS dynamite underneath. Her main interest lies ln the Army Air Corps. HEATH, PHYLLIS Phyl is the demure brunette who's always getting confused with her cousin Joan . . . well, let's say con- fused-period . Quiet and charming, she'll go places. HEGEDUS,, JOHN uhlblagf! K'Hag is a great lover of the out-of-doors and partici- pates in a great many sports. He plans to study more on aeronautical engineering. . HENRY, GROVER This Air Cadet is considered among his friends as a B. T. O! Grover is one of the wizards in Coach's chemistry Club. HEPLER, WANDA Wanie I Wanie , who has been a versatile athlete, would like to become a waitress after graduation. Her extra time is used in dancing, skating and collecting pictures. HICKMAN, JACK ' Meet the typical Man-About-Town! Popular, his future lies in the armed forces. HICKMAN, THOBURN Thoburn is a quiet fella but one grand guy. We'll look for you at the top of the ladder, Thoburn. HLAWATI, ROBERT EDWARD unDunk-9? Machine work is Dunk's interest but heseems to get around with the girls in his leisure time. Hunting also fills in his spare moments. HOLLABAUGH, J OE Fuzzy Fuzzy is a splendid combination, of student, active larmer, and mechanic. We know he's sure to succeed. 109 HOLLENBECK, ALICE EMBIA npinkyn Pinky is a quiet unassuming girl who plans to be a typist after graduation. ller hobbies are sewing and collecting odd dishes. HOLTZ, DOROTHY Chick', The mellow tones of Chicks violin are heard at every production on Senior stage. She likes to ride a bike and is well fitted for her chief interest in music. More power to you, Dorothy. HUEFNER, JOAN 4'Huefie Huefie, with the brown hair-green eyes combination, is another attractive girl in our class She likes to collect post cards and is a future lah technician. INGRAM, RALPH lilnkyii One of Senior's boys who left before graduation to enter Uncle SaIn's Air Corps for pilot training. The girls are sure to remember that dark wavy hair. JASIOTA, DIARY Shorty A capable, efficient member of the secretarial group. Mary is bound to become a good secretary. She also stars on the gym floor. JEFFREY, VIRGINIA - Jeff Bang! Crash! Coach's prodigy is at work again. Any fiendish experiment willusually have Jeff as a source. Her main hobby is keeping W. W.'s cars busted. JERKO, JOSEPH .Hoes Working in his dad's store takes up most of Joe's time. He is a whiz on roller skates as well as on ice skates. He is also interested in building model airplanes. JOHNSON, HARRY - Blondie Blondie left to wear Uncle Sam's khaki at mid-term, but he will always be remembered in the Oil-Gas shop. His friendly ways have won him a great many friends. JOHNSON, HELEN Johnny Helen is a staunch pillar in the A Cappella choir and without her, Senior would be much duller. She l1as no definite plans for the future, but her versatility assures her success. JONES, MARILYN .lonsie A brilliant member of the Latin Class and she plans to increase her knowledge by attending college upon graduation. With her wit,', she is sure to get ahead in life. 110 JONES, ANITA Ani . Neat is Mr. Foster's question and answer stand-by. Quiet, cute, and loads of fun. KARASINSKI, SOPHIE i Hereis one of the library's busy bodies. Sophie's been cheerful and helpful working during her years at Senior. We are sure she will be a great success after leaving her Alma Mater. KARNS, RAY Buzz - Buzz is one of our best known Seniors. His winning personality and friendly grin made him pals with everyone. He deserves much credit for the maintenance of the Hub Club and his splendid football record. Keep on the ball Ray, and you ean't lose. KARNS, HAROLD ..Hal,, ' We remember sandy-haired Hain for his outstanding Work in the art department. Wonder if he's sketching battle scenes now with the Army. KAY, CHARLES As his friends and Mr. Foster will testify, Chuck when it comes to general mischief, is really on the ball. KENNEDY, RICHARD tlRiCh!! Rich is very much interested in his music. From his exploits this year in Chemistry, we think he is quite adept in this. Bang! KIFER, VIVIENNE Kife Oh! the other half! This 'A Kite is a real wit and loads of fun. She! usually found in the library. HKife has outstanding ability in the line of art and, though her future is, as yet, indefinite, she will probably go far in this field. KING, MARY THERESE Tese Tese is one of our future angels of mercy. We remember her as the capable and efficient manager of the Magazine and Christmas card campaigns. KISKADDEN, JOSEPH 46.10617 Joe is one of our Senior lads who goes steady. He plans to attend college and soon we'll all be saying. we knew him when . . . KITCHELL, DAVID ETON Dave's main interest is in aviation and he spends all his spare time increasing his knowledge on the subject. Having a great sense of humor, he IS sure to go far in the World. 111 K LAPEC, CHESTER A I Chester's the congenial, self-reliant type. Full of tricks, he'll have a host of friends wherever he goes. KRAFT, JEAN MARIE Jeanie This pretty little miss is very much interested in the Air Corps, especially Jim. Jeanie plansuto be a beauty opera tor after graduation. KRUG, LORRAINE BETTY Krugie ' Pee Wee Here is the little blond lass who always greets every- one with a friendly smile. An accomplished jitterbug Pee Wee is quite at ease on the dance floor. KUGLER, PHYLLIS mph-yi!! 'tPhyl is a tall lass with naturally curly hair, dimples, and also the unique hobby of collecting napkins. We envy the lucky patients of this future cadet nurse. KULL1No, ADELINE miie ' Akie's future includes the donning of a nurseis cap. Future patients of hers-be careful of her cute smile. Loads of luck to you Akie. KUTYLA, MILDRED Millie - - Millie, the tall, blue eyed blond from 322, heads her future toward the position of being a book-keeper. Millie's neat appearance will help her in the future world. Seniors will never forget her bashful smile. LAUFFER, RUTH ' Ruth is one of our quiet Seniors. Her school records show that she will become a good secretary. Seniors will ripmoiblmber her habit of chewing gum. Good luck to you ut . LESLIE, MARY JEAN NI-less: Les, one of our best known Seniors who swims like a fish-what a lovely fish! She is an all-around athlete whose basketball tactics will help her in handling patients in the nursing career. LINSEY, JEAN aockyn Although Jean has been here only one year she has made many friends. Much of her interest goes to singing which she has chosen for her future occupation. LooAN, RoBERT CALVIN, 'KLogie , - Logic is well-liked because of his active participation in extra-curricular activities. Because of the splendid job he did on the photography for the Can , we're sure lw'll go far with this as an interest. 112 LUIJWIG, RODNE Y Rod Here's a toast to Senior's dramatic diamond-in-the- rough. When not on the stage, he can usually be found battering a piano. Someday he'll be an engineer. LYNCH, JERRY - Irish Everyone will always remember Jerry withhher lovely red hair and merry grin. The Navy is her special lIlt,0l'0S1 and she plans to become a stenographer. V McCASH, WILLIAM Bill Bill's the loyal stamp-and-bonder of room 211. Al- though the Navy will probably take up his time in the near future, his industry and diligence assure him a good place in whatever field of vocation he enters. lN'IcCLINTOCK, CHARLES Chile Chile is the chemist ol' the Oil XL Gas Club and is an ardent automobile enthusiast. Model airplanes and weld- ing take up most of his time. McCOLLUM, JEAN Jeannie A i'Jeannie is a mainstay in almost all the music groups and a Awhiz on the stage. We certainly will miss her winning smile after graduation, but maybe she'll be back in later years as Mitch's'suceessor. lN'IcDANIEL, MARY Mary's intelligence is easily proven by her record as an honor roll student. One of her chief interests is music which will probably provide amusement during her spare moments in training as a nurse cadet. McELHATTEN, MARY ' I Mary's new here this year, but already she has con- tributed a lot to our activities. We'll miss her. lN'lcFADDEN, JANE .lane's chief characteristic is coquetry. l or amuse- ment she collects football pictures, and she'd like to be an alr hostess when she graduates. McGILLICUDD Y, BETTY .iMaC,, Betty's keen sense of humml doesn't leave much to be desired. There isn't any doubt that her ability will win her a steady job in the business world. MeKEAN, DOLORES JEAN nDaa t uiet D s ends her leisure hours takinf' ictures. 1 - 4 an - She IS a seniorlte who plans to undertake the industrious life of a secretary. 113 lVlcLANE, SUSAN YVONNE usuzyv If you hear a shrieky laugh, you can be sure that it's Suzy. Although her hobby is ice skating, she is also very much interested in acting. McLAUGHLlN, EDWARD .gMaC,, Ed, the tall, lanky, quiet senior, plans to go out into the business world, and he probably will take his hobby, photography, with him wherever he goes. lid is the key man at the Derrick Co. MCQUOWN, TERRY Terry is responsible for all the swell sports page write- ups you've read in the Senior Hi-News for the past two years. This lanky, curly-headed lad has acquired a re- markable Ugift-o-gab. Terry is a good sport and is liked by his many friends. lVlacDONALD, VIRGINIA 4'Ginny Ginny is an out-spoken girl with ambitions to become a doctor. During the summer. she was a life guard 'at the city pool. She often stumps Coach with her witlclsm. McLAUGHLlN, EMMY LOU ..ISh,, ulsh' was a class favorite this year. livery one wel- comed her wherever she went-especially those members of the opposite sex. She has quite a few sweaters which she has knitted that shows her ability as an accomplished knitter. MALVASO, ANN Ann is desirous of gaudy clothes. She has a good sense of humor which will come in handy for her future vocation-nursing. MARTONE, LOUISE Lou A pleasing personality, pretty dark hair and eyes, and a reserved manner are the main qualities of this quiet senior. MAST, JUNE L. June, a Warrant Officer in the C. A. P., is quitc in- terested in aeronautics. Aviation takes up a lot of her spare time, but she plans to enter business school after graduation. MEABON, EVELYN LOUISA 1 We're sure the life of a pedagogue is just the thing for REV. She's quiet, neat, nice looking, and accom- plishes well everything she undertakes. MIETUS, MARY JOSEPHINE H.lose Quiet, friendly Mary surprises us with her interest in Western Music. Stl1dlOllS, even though her plans are in- dellnlte, we are sure she will succeed in her chosen field. 114 i l L l . MILD, FRED ' Fred, the mainstay of the handls trombone section. toots a mean horn! He plans to take up pharmacy after graduation. Has a 'tone and only. He's identified by his familiar Hwang MILLER, BLAIN E Alfalfa Alfalfa is usually found in the auto shop-making the cars fit to run. A well-rounded personality makes Blaine well liked. llis chief interest, auto mechanics, will take up his future. MINTZ, DAVID Muzz Muzz is the voice of Senior. We shake in our shoes every time he speaks those fatal words, Will . . . please report to the office immediately. And, he's usually tops in dramatics. Moons, FLORENCE ' Florence is reserved and quiet. Her main activities he ln the muslc group where her alto voice IS indispensable. MORGAN, VIVIAN lf you see a tiny, cute girl rushing through the corri- dors, you'll find its Vivian. Collecting what-nots take up her spare time. She wants to be a pharmacist. NIORRISON, MARY LOUISE There aren't many girls in Senior with natural curly hair, but Mary is one of the lucky ones. Her vocation of a beautician seems quite appropriate. BIOTTER, DONALD Donn Don, whose hobbies are hunting and fishing, plans to be an engineer. We wish him all the luck he desires. NIOYAR, MILDRED 5LMid7S i Mid usually can he found reading books or listening to the radio. Having completed the general course, she plans to become a cadet nurse after graduation. MURPHY, J. PATRICIA Murph Murph's striking blonde hair together with her sweet smile makes her one of Senior's outstanding girls. She can usually be found wearing the latest colors and styles in sweaters. MYERS, DEAN Send A A boy who delights in teasing the girls is this future mechanic. lf4'ASend can keep the cars rolling as well as he keeps his skates going at the rink, he's sure to he a success. MYERS, l,Al'RA Laurie K Laurie is our unliring and never-failing cheerleader. blue has-been one since her junior high school days, and she IS the flrst female member of the Yarsity-0-Club. NELSON, MARYADA v This is Maryada-the girl who gets all A's . Besides being very sagaeious, she is very adept at sewing, and she would llke to become a nurse. NICK, SUSAN 'LSusie i'Susie is one of the more reeitent girls of Senior. Besides collecting pin-up servicemen, she is a proficient seamstress and enjoys bowling. NICKLIN, BRYAN Barney ' Because of 'KBarney's wit, good humor, and friendli- ness, his classmates never have a dull moment. His future hes with the Air Corps. NOVAK, FRANCES Franny Franny is one who is right in step with the latest fad-especially that of going steady. VV e hope Joe misses her as much as we will, when she enters training. OLSZOWSKA, EDWARD t'Ed This quiet, bashful fellow of 222 left before graduation for the Army. We know he will be a success at whatever he does. PARKER, GAYLE Ace This handsome hunk of mann is equally at home on the gridiron as on the basketball floor. We must not for- get his singing ability. His chief interest is raising chickens? if El PA YNE, RICHARD 66Dick!I 'LDick, one of our honor students, left for service in March. ,Backed the basketball squad all the way with his fine management. PRITCIVIARD, MAR Y usisvr ' Although '6Sis', came to Senior only last year,she has acquired a host of friends. lf you see a neat, good looking girl with a friendly smile on her face-'l'hat's Sis. PF EN DLER, DU AN E r l innegan 'il innegan in that green club coupe of his is certainly Clk! fHi'llIlll6g8I1,7 vie meanj. The auto shop will miss its secretary when he graduates to become a diesel engineer. 116 PFENDLER, ROBERT Bob is noted for his modesty and industry. lle'll go far in the business world. PIEKUT, FRANCES Fran s'l ran is another one of Senior's quiet lassies. Besides taking pictures, this future secretary loves to see movies. PINER, SHIRLEY Quiet Shirley is one of the friendliest girls in the Class of '45. Our best wishes go with her. PLISKA, MILDRED Mildred is very accommodating and also very punctual about everything she has to do. She enjoys reading and plans to get a higher education. POLRI, EUGENE Gene A'Gene is another one of Senior's boys who lives down in the vocational shop. We will place his bid in the en- gineering world. Letls wish him luck. POULSUN, JOANNE Milos: ' At present .lo's chief interest is bowling, but she plans to become a heautieian. Her radiant personality will be a valuable asset to her. POWERS, FERN LUCILLE Vern Here we have a girl with a very original future-that of a farmerette. X'ern,s spare time is spent in reading or swimming. PRICE, HENRY Hank , Taciturn Hank is one ol' those rare specimens who is unobtrusive. Our best wishes go with him wherever he goes. PRITCHARD, MARJORIE Meet the girl who always greets you with a cheerful Hifi IIere's hoping her future life as a heaulieian will be a success. PERTZ, BETTY Pertzie Pertzie,s interests center on writing letters and keep- ing in touch with a certain sailor. She possesses a keen sense of humor that finds its way into those original and droll writings of hers for the News 117 PULEO, CARL FRANK Frankie Ah, yes, Frankie has kept school alive these four years with his active participation in all the musical activities. Not only can he swoon the bobbie sox with his voice, but he can cut a mean rug. Sh-h-h! His main ambition is to be a second Mr. Runzo. RAY, ARNIE Senior will miss this car drivin' man. Always to be seen where mischief IS afoot. Arnie left for service in March. REESE, SIDNEY sg w- us bid The football fellows will never forget Sid at ball camp this past fall. Carnival Oats Reese, as he was called in those days, was the pet nuisance of the cooks. Reese is Senior's only two letter winning manager. REINING, DORIS Dorie Nursy come over and hold my hand! The wolf call of the hospital after Dorrie starts trainin f. She's bound ga to cause a lot of high temperatures and fevers with her long blonde hair. REMALE Y, ALVIN MAIN - You will always see Al going around in a flashy green Chevy. llis plans for the future-Navy Bound. RIGLEY, GRACE A Torsus f'Torsus's auburn hair explains her nickname. Her plans for the future are indefinite, but at present she spends her time bowling and skating. RITCHIE, NORMA Norma is another one of Rouseville's contributions to Senior. During her four years at Senior, she has been very active in the music circles and has a friendly grin for everyone. ROBINSON, RUTH Gunner Wherever tl1ere's music or mischief, there's bound to be Gunner. Her pleasing personality will Win her many friends when she goes to college next year. RODGERS, ROBERT GRANT ..B0b,, V A Bob helps to keep the social and financial affairs of the Hub Club running efficiently. Bob has a score of friends who will miss him when the Navy takes oven RODGERS EDDII' Sonn1e l ddle s scholastic iuoid is outstanding and his achievements in music are enviable. lle is dubious as to whether hefwill pursue music or make-upas his vocation brit-whatever it is. he is bound to succeed we sfisy . - . - .' - vs V 53 H E fp : ' Q 'rw . f ' . R ., M . V ' 4, , 55' -' , 5, fi: 3 - - -T , 2. , 'Q .:. - fr . Q,,ffsgFs. i1 ttf A ' : A M2539 .geza sw Ei - 1.-:gf :Sf.Q.'-,gy A - eaefgsgsg .g ig 118 , 5 I ,1 i liege - RODGERS, GLENN Glenn can always be found with a smile, whether singing or talking. A true outdoorsmang he is a quiet. friendly chap. RODGERS, MARYLIT 4sLuss I Why teachers grow gray! Lu just can't seem to sit still in classrooms. but her man' friends en'oy her h N J . umor. ROSS, JEAN .lean's ambition is.to become a teacher, She loves to read. and her charming nature will assure her of success. ROSS, ROBERT RICHARD nB0bss Bob spends his spare time around machines. Al- though his plans for the future are indefinite. we are sure he will succeed. ' g RUSS, RUTH 6LRuSty91 Rusty, the heroine of our Senior Class Play is one ol' the outstanding beauties of 45.', Need we say more? RUTHERFORD, KENNETH A Kennie One of the mainstays of the stage force. this little fellow is quite the guy. lle was also active in the music groups. R YCZKO, CHARLOTTE PATRICE ..Kay0,, Kayo keeps 'em rolling in the aisles with her oral topics. Everyone envies that privilege of coming late to classes, which being an office girl affords her. SAMPSELL, SHIRLEY JEAN H ' One of Senior's music geniuses who can really make the ivories tinkle. Quiet, petite and right on the ball when grades roll around. SCH ELL, JOI IN Huck', Huck is happy-go-lucky and one swell guy. Like many others his chief interests lie in sports and the Navy. SCHELL, MARY MARGARET nsauyo Sally is'a rather quiet senior who plans working in a store after grad uation. She is a true friend and a regular book-worm. Y 119 SCI INEPP, TIII-IRESA MAXINE Theresa in appearance is rather quiet but it's a differ- ent story when you get to know her. She has no definite plans for the future but we know she will succeed in any vocation she chooses to follow. SHARP, ANN i'Sharpie,' ' - ' Sharpie is a very witty little character-everyone's friend-who should ask for more? She plans to attend college after graduation. l'Ier violin is her closest pal. SHERMAN, MILDRED Bebe u L'Bebe is our little blond bimdle of gab. Classmates will remember her splendid performances on the stage. Flea is noted in music as well and will make a success of 1 e. SHIELDS, JAMES EDWARD ansparkyw .lim is interested in swimming and girls. His plan l'or the future is to join the Navy. Ilere's luck to you! SHOOP, NAOMI Shoopie Shoopie is a happy-go-lucky kid and will always help others in need. Swimming is her chief interest and she plans to be a beautician after graduation. . SLATER, BETTY Betts enjoys all sports and intends to become a secretary after graduation. Her sparkling blue eyes attract everyone. SMIDER, DONALD Mouse Senior is certainly going to miss 'iMouse wl1en he graduates. Not only has he contributed greatly to the musical success of our school,x but he has also appeared in many of our dramatic presentations. He is best known probably for his sharp, keen sense of humor. SMITII, PATRICIA RUTH A Hpattyu Patty is sure to be an asset to any training hospital. She's one of those individuals who knows.the field of music. SMITH, PHYLLIS FA YE ..FizZ,, I . Fizz, a high stepping Senior of 222, has a sense ol' humor-that sends us all. Her hobby is collecting animals that will be the starting of an Oil City Zoo. SNYDER, PATTY ..Pau'y,, liven though Patty, a very quiet member of our class, has no definite plans for the future, we're sure she will succeed in anything she may undertake. She sews and collects stamps in her spare time. 120 STAHLM AN, RUSSELL R uss Russ, a potential oil engineer, when not busy with his oil interests, finds time to enjoy his hobbies of hunting and fishing. lnterclass basketball and Oil and Gas con- stitute his extra-curricular activities. STOUGHTON, RICHARD Equally at ease on the gridiron or hardwood, Dick is our honorary football captain and president of the Varsity O Club. This handsome guy, who makes the girls sigh, hfas a noted faculty for turning up whenever mischief is a oot. A STRICKENBERCER, RUTII GENE V Stricky Looking for 'fStricky ? Then it's a ten to one shot you can find her in Dot's famous Bug,'! Her red hair, dimpled chin, are the envy of her classmates. . SWACIIA, FRANK RAYMOND lfranek' ' Neatness personified. I ranek,' has a very pleasing personality but is a little bashful. He plans to become a navigator in Uncle Sam's Army Air Force. SWATSLER, CAR MEN ' fCar'm Carm is a neat dresser and possesses a swell person- ahty. Her main desire after graduation IS to become an office worker and her chief interest is music. SWOGER, PATRICIA ANN upatsyn . Patsy owns a cute grin, pretty brown eyes, and hair just red enough to set off the nurse's cap she plans to don. SZABAT, JOHN FRANCIS Sabby Sabby', is interested in civil engineering and plans to make that his future occupation. He is also accomplished along the literary line. TAFT, RAY Farmer' ' Farmer hails from the machine shop. You can tell from his nickname what the future holds for him. Here's wishing him lots of luck. TAhIBURINI'I, JULIE Pee Wee 'fPee Wee has a combination of several typeseshffs vivacious, petite, clever. and loquacious. Senior's losing .a good student when, she leaves, TAYLOR, PIIYLLIS 'fPhyl . Phyl is the girl who is so sweet on the trumpet and on the vocals. She plans on being a laboratory technician. Collecting :logs and reading good books are her hobbies. 121 TEETER, GEORGE Here is the originator of those super-signs that have adorned our study hall walls. Although he is interested in aviation, women are not out of his line. TOCK, PAULINE Polly Polly has pretty blond hair, a cute smile, and is always friendly. We hope to see her as a chief book- keeper some day. TO Y, MARIE HRH , ' These two words, true friend best describe Marie. Although not very well known, she is always a friend to those she knows. TRZUSKOT, HELEN LOUISE Cookie' ' Cookie is full of pep and shines in dancing. After graduation she plans to be a beautician. UDICK, FRANK ffskipr Skip left us before graduation for a gob's suit. If he does as well with this suit as he did with those he wore here, women prepare to swoon! ULRICH, MARY I med., Mary's interesting hobby is collecting friends. This knack will undoubtedly help her immeasurably in the nursing profession. UREY, LOUISA MAY k'Nikki We think Louisa is just about the most versatile and nicest girl in our class. She has participated in many music activities, written posters for innumerable events and undertaken the thankless job of Literary Editor of the Can. NVAGNQER, KERETTA Keretta is one of the fairer members of our fair sex. Although undecided as to her future. she is bound to become 'a success. WAIJENTOWSKY, IRENE Here's a quiet, well-liked senior from 224. We're sure Ike will make a good nurse wherever she goes. Collecting pictures of famous singers is her hobby. WATTS, CAROL ANN A 4'Wattsie Wattsie as she is known to her friends, aspires to be a dietician so we'll soon be seeing her weighing out all the calories and planning those hard-to-follow diets. 12 41 L4 123 WEAVER, MARY JANE MM. J. We will remember M. J. for her dramatic ability. M. ., a sweet and pretty senior, has displayed her dramatic ahlllty on the stage of O. C. H. S. WEAVER, MIRIAM Swivel - Swivel islnoted for her smooth clothes and her line. Perhaps she will have a dress designing salon of her own one of these days. WILTANGER, WALTER ..WalL,, I - Walt, another of our vocational gang, excels in swimming. His many friends will miss him when he sails for the Navy. WOLBERT, RITA When Rita flashes that pretty smile on her future patients, they're sure to get well quick. Her classmates will remember her for her lively chatter and ready wit. WORK, RUSSELL Russ Russ is one of our many mischievous Seniors. If you see a blue Chevie whizzing by, that's Russ. Another one of our future sailors. WORKRIAN, ANNA MARIE NADH!! Always ready to lend a helping hand to a friend in need. Ann is also an honor student. Come on, Ann, tell us who A'China is! WRIGHT, ELNETTA SYLVIA Toots Toot's cheerful grin and friendly nature win her many friends. Although she has no definite plans for the future, she's sure to find success in whatever she does. WYDRO, HELEN We're sure that Helen, with her friendly smile and her pretty eyes, will some day be a swell gym teacher. Although her interest lies in the sports world, she's been a loyal member of the library staff for three years. YASHINSKI, TONY Tony is a vocational student and is not seen much on the upper floors of the school. He will make a pretty nifty sailor after graduation. ZIEMBA, BIAR Y FRANCES Kriss A'Kriss is prominent in sports and home economics. She's gonna be the gal-hehind-the-counter soon at the A. 81 P. BEST ALL-AROUND MOST ATHLETIC ..4. BEST ARTIST .,... BUSIEST ............ MOST POPULAR ...... BIGGEST GBIND .... . BEST LOOKING ....,, MOST HUMOROUS ..... ..... MOST KIDDISH ...... FUSSIEST ........ TALLEST ....,..,....,. MOST LOQUACIOUS. . I . . . . . , BEST DANCER ...,. . MOST FRANK ....... BIGGEST BLUFFER ...,, ..., SLEEPIEST .......... BEST SPORT.. ...... ., BIGGEST CUT-UP ..... BIGGEST TEASE .,....,.. .... MOST INTELLECTUAL .... .... MOST FORGETFUL .... MOST MODEST I... FRIENDLIEST ...... BEST MUSICIAN ...., BEST ACTOR ....... BIGGEST LATER ..................... anion Sulfnenflatlvacm ling gunion CQQAA SQ:-:ctlon RUTH BIELENBERG. MARY JEAN LESLIE VIVIENNE KIFER .... JEANNIE STOUDT. . . RUTH BIELENBERG. BETTY KRUG ........ RUTH RUSS ..... JOAN DOLBY ..... VIVIAN MORGAN .... .BETTY BAHR .... JOAN DOLBY ........, MILDRED SHERMAN ,... .... BETTY BAHR ,....... PATRICIA MURPHY. VIRGINIA KIFER .... JEAN ADAMS .,.... MARY JEAN LESLIE MARY JEAN LESLIE. PHYLLIS TAYLOR ..,. .... LOUISA UREY ..., JOAN DOLBY ....... JOAN CAVANAUGH. . RUTH BIELENBERG. JEAN MQCOLLUM .... MILDRED SHERMAN .... .... VIRGINIA JEFFREY. JOH GREEN AWALT RICHARD STOUGHTON GEORGE TEETER JOHN GREENAWALT JOHN GREENAWALTI JOHN DUINK RICHARD STOUGHTON ROBERT REINSEL BRYAN NICKLIN .JOHN GREENAWALT BRYAN NICKLIN RICHARD STOIIGHTON FRANK PULEO WILLIAM FARLEY RAY KARNS THOMAS HAHN DAVE PEA RSON BRYAN NICKLIN RAY KARNS CHARLES AMES RAY KARNS JAMES SHIELDS JOH N GREENAWALT ROBERT CHACONA LEE HANNA ROBERT REINSEL BIGGEST MAN-WOMAN HATER ................... THERE ISN'T SUCH A THING IN SENIOR! 124 ABBOTT, CHARLOTTE Spring Concerts Cvocalb 1, 2, Library Staff 2. 3, 4, Girl Reserves 1, 2, 4, Chemistry Club 4, Latin Club 1, , 2, Etiquette Club 2, 4, One Act Plays 3. ADAMS, ,IEANNE Girls' Interclass Basketball 2, Home Room Secretary 4, A Cappella 3, 4, Spring Concert Cvocalj 3, 4, Girl Reserves 2, 3, Pep Squad 4, One Act Plays 3. AITES, BETTY Spring Concert Cvocall 1, 2, 3, Girl Reserves 1, 2, 9th Latin Club, Home Economic Club 3, 4. ALLEBACH, THEODORE Student Council 4, A'Cappella 3, 4, Senior Play 4, -Mystery Play 2, Tune In 2, Spring Concerts Cvocalj 2, 3, 4, Ili-Y 2, 3, 4, Amateur Broadcast 2, Nominat- ing Committee 3: One Act Plays 2, 3. ALSBAUGH, J-EAN A Cappella 4, Spring Concerts Cvocalj 1, 2. 3, 4. ADIES, CHARLES Auto Shop Club 3, 4. ANDERSON, BETTY LOU Ilome Room Treasurer 4, Guidance Representative 4, One Act Plays 3, 4, Spring Presentations 3. ANDERTON, WILLIAM Home Room President 1, Oil Can Literary 4, Senior Hi-News Literary 4, A Cappella 3, 4, Operetta 3, 4, Spring Concerts Cvocalj 1, 2, 3, 4, Ili-Y 4, Camera Club 1, Senior Ring and Pin Committee 4, Any- thing Goes 3, Il Trovatore. ANDREWS, ELLEN Spring Concerts Cvocall 2, 3, 4. ANDREWS, JOAN Eprgig Concerts Cvocalj 1, 2, Latin Club 3, 9th Latin u . ' APPLEQUIST, KATHRYN IIELEN Girls' Interclass V olleyball'4, Pit Orchestra 3, 4, Senior Elayj 4, Spring Concert Cinstrumentj, Chemistry u 4. - AIQSEL, PAUL IIOM ER A Cappella 3, 4, Operetta 3, 4, Spring Concerts Cvoealb 1, 2, 3, 4, Stage Force 2, 3, 4. BAHR, BETTY Business Staff Oil Can 3. 4, Marching Band 3, 4, Pit Orchestra 1, 2, 3, 4, Girls' Swing Band 3, 4, Music Club Council 4, Girl Reserves 1, 2. BALOT, CECILIA LOUISE Girls' Interclass Volleyball 1, 3, Girl Reserves 1, Eti- quette Club 1, 2, 3. ' BANKSON, ARDELLE E. llome Room Treasurer 1, Student Council 1, 4, , A Cappella 4, Operetta 4, Spring Concerts Cvocalj I, 2, 3,'4, Girl Reserves 4, Etiquette Club 2, Pep Squad 2, 4, Guidance Representative 3. BEHRINGER, AIARGARET ANN Spring Concerts Cvocall 1, 2, Spring Presentations 3, Pit Orchestra 4. BENNETT, ROBERT Student Council 3, Auto Shop Club, Senior Nonimat- ing Cornmittee. RIELENBERG, RUTII Girls' Interclass Basketball I, Senior lli-News Literary 3, 4, Athletics 4, Spring Concerts Cvocalj 2, 3, Girl 125 Reserves 3, 4, Etiquette Club 2, 3, Pep Squad 2, 3, 4, Cheerleader 3, 4, Xmas Card Committee 4, Prom Committee 3, Spring Presentations 2, 3. BIELISKI, LEONA A Cappella 4, Spring Concerts fvocalj 1, 2, 3, 4, Spring Presentations 3, Pep Squad 4. BILLS, CECAL BEATRIX Etiquette Club 2. BLAUSER, OLIVER ALFRED Boys' Interclass Basketball 3, 4, Freshman Football Squad. BOWER, HELEN JOAN Etiquette Club 2, 3, 4. BRADFORD, DOROTHY , A Cappella 4, Opcretta 3, 4, Spring Concerts Qvoealj 1, 2, 3, 4-. BREWSTER, NORMA Home Room Secretary, Spring Concerts Qvocalj 1, 2, 3. BRITT, IVAN LEROY Spring Concerts Cinstrumentj 1, Machine Shop 2, 3, 4. BRUNO, FRANCES JANE Girl Reserves 1, 2, 3, Latin Club 2, Etiquette Club 1, 2, 3, Pep Squad 1, 2, 3. BRZUZ, LOTTIE Senior Nominating Committee. BUCHNA, ROBERT CHARLES Latin Club 2, Senior Ring anf Pin Committee. BUCHNA, WILLARD H Boys' Intra-mural Athletics 2, 3, 4, Student Council 3, Ensemble Group 4, Home Room President 1, Machine Shop 2, 3, 4, Senior Nominating Committee, Spring Presentations 1. BUDZINSKI, WANDA Girls' Interclass Volleyball 4 and Interclass Basket- ball 1, 3. ' ' BURT, RICHARD ' Oil SL Gas Club 2, 3, 4. CARLSON, JOAN Chemistry Club 4, 9th Grade Latin Club. A CARPENTER, ROBERT Football 2, 4, Interclass Basketball 2, 3, 4, Operetta 2, 3, Xmas Music Program 2, 3, Spring Concert Cvocall 2, 3, Northwest Chorus 2. CARSON, VIRGINIA Interclass Basketball 1, 2, 3, Xmas Music Program 3, 4, Spring Concerts Cvocalj I, 2, 3, 4, Etiquette Club 2, A Cappella 4. ' CAVANAUGH, JOAN Spring Concert Cvocalj 1, Oil Can Business Staff 4, Speech and Dramatics Club 2, Latin Club 3, Pep Squad 3, Spring Presentations 2, Chemistry Club 4. CHACONA, ROBERT Tune In 2, Interclass Basketball 4, Boys' Swing Band 2, 3, 4, Marching Band 1, 2, Student Director 3, 4, Guidance Representative 3, Amateur Broadcast l, 2, 3, 4, Hi-Y 2, Vice President of Hi-Y 3, Secretary 4, Spring Concerts 2, 3, 4, Trumpet Trio 2, 4, Brass Quartet 3, Pit Orchestra 1', 2, 3, Student Director 4, Senior Play 4. CIEPLECHOW l CZ, HENRY Oil' Sz Gas Club 2, 3, 4, Guidance Representative 4. CLARK, HELEN ROSE ' Girl Reserves l, 2, 3. CZLONKA, JESSIE Volleyball Player 35 Basketball Player 35 Spring Presentations 3. DAILY, BARBARA ANN Junior Class Vice President 35 Home Room Secretary 25 Oil Can Literary Staff 3, 45 Senior Hi-News Business Staff 3, 45 Senior Play 45 Spring Concerts Cvocalj 1, 2, 35 Spring Presentations 35 Library Staff 2, 3, 45 Girl Reserves 2, 35 Chemistry Club 45 Mystery Play 4. DeARMENT, ERLA MAE Student Council 15 A Cappella 45 Opera 45 Spring goncirts 1, 2, 3, 45 Girl Reserves 45 Etiquette Club , 3, - DOLBY, MARION JOAN Oil Can Business Staff 45 Marching Band 35 A Cappella 45 Girls' Quartet 45 Opera 45 Spring Concerts Cinstru- mentj 35 Spring Presentations 35 Girl Reserves 3, 45 Chemistry Club 45 Latin Club 35 Pep Squad 35 Magazine Campaign 35 Senior Play 4. DOLECKI, HELEN Etiquette Club 2. DRISCOLL, PATRICIA Speech and Dramaties Club 45 Latin Club 35 Etiquette Club 3, 45 Spring Presentations 2, 35 Senior Play 4. DUINK, JOHN Tune In 25 Spring Concerts Cvocalj 1, 25 Hi-Y 2, 3, 45 Chemistry Club 4. EISMONT, ANTHONY Oil SL Gas Club 2, 3, 4. ELAHI, RUTH A Cappella 3, 4. LMANUELE, ANNA BIARIE Opera 45 Spring Concerts 2, 35 Latin Club 2, 35 9th Grade Latin Clubg Xmas Card Committee 45 Magazine Campaign 3. EMBLETON, DOROTHY JANE Girl Reserves 35 Etiquette Club. FARLEY, WVILLIAM Camera Club 3. FLEISCHMANN, RICHARD Boys' Intra-mural Athletics 1, 25 Oil Can Literary 45 Machine Shop 2, 3, 4. FORBES, ARVID' Auto Shop Club 3, 4. FR Y, HELEN Marching Band5 Girls' Basketball Captain5 Religious School. GARDNER, RUTH A Cappella5 Christmas Music Program5 Girl Reserves5 Chemistry Club5 Etiquette Club Secretary. CAVIN, JOHN Oil Can Business and Photography Staffsg Senior Hi-News Business 3, 45 Hi-Y 1, 2, 45 Camera Club 35 Chemistry Club 45 Latin Club 1, 2 5 Amateur Broad- cast 2. Gl' GOGEINE, PHYLLIS A Cappella 45 Spring Concerts 1, 2, 3, 4. FFORGE, ROBERT CLAIR Home Room Secretary 45 Machine Shop Club 2, 3, 4. GILLILAND, JOAN Girls' Interclass Basketball 1, 2, 35 Girls' Interclass Volleyball 45 A Cappella 3, 45 Spring Concerts Cvocalb 1, 2, 3, 4, and Cinstrumentj 3, 45 Pit Orchestra 3, 45 Chemistry Club 45 Pep Squad 35 Girls' Quartet 45 Senior Play 4. GOODMAN, CLEON IRWIN Oil Sz Gas Club 3, 45 Boys' Interclass Basketball 4. GRAFF, HELEN ELIZABETH A Cappella 45 Operetta 45 Spring Concerts fvocalj 1, 2, 3, 45 Etiquette Club 3, 45 Freshman Nominating Committee. GRAY, JOHN H. Football Varsity 3, 45 Basketball Varsity 45 Spring Concerts Cvoealb 1, 2, 35 Hi-Y 1, 2, 3, 4. GRAZIER, JACK Auto Shop Club 2, 3, President 4. GREENAWALT, JOHN W. Class President 1, 25 Varsity Football 2, 3, 45 Junior Varsity Basketball 25 Varsity Basketball 3, 45 Oil Can Editor-in-Chief 45 Freshman Football Squad5 9th Basketballg Student Council 15 Student Council Treasurer 2 and Vice President 35 Pit Orchestra 25 Hi-Y 1, 4 and President 2, 35 9th Latin Clubg Pep Squad 15 School Rotarian 45 Junior Nominating Committeeg Chairman for Junior Prom5 American Legion Award. GUNDERMAN, MURIEL 9th Latin Club. HAGERTY, HELEN Home Room Secretary 45 Marching Band 1, 2, 3, 45 A Cappella 45 Spring Concert Cvocalj 1, 2, 3, 45 Library Staff 2, 3, 45 Girl Reserves 3 and President 45 9th Latin Clubg Amateur Broadcast 2, 35 Pep Squad 45 Girls' Swing Band 2, 3. 45 Girls' Quartet 4. HAGERTY, JERRY Freshman Class Treasurer5 Boys' Interclass Basket- ball 1, 2, 45 Marching Band 2,35 Basketball Band 3,45 Spring Concert Cvocalj 1, 2, finstrumentj 1, 2, 35 Music Club Council 45 Hi-Y 1, 2, 3, 45 CSecretary 1, 395 Latin Club 2, 35 9th Latin Club5 Amateur Broadcast 35 Senior Play 4. HAHN, THOMAS Junior Class Treasurerg Student Council 35 Hi-Y 1, 2, 3, 45 Home Room President 2, Secretary 15 Junior Prom5 Interclass Basketball 3, 4. HALL, DORIS ANN Oil Can Business 45 Senior Hi-News Business 3, 45 Libr ry Bowlin 2, 3, 45 Spring Concert Cvocal and instrumentj 1, 2, ' 5 Library Staff 2, 3, 45 Girl Reserves 2, 35 Latin Club 25 9th Latin Clubg Senior Play 4. HAMILTON, HARRY - Machine Shop 2, 3, 4. HAN NA, ARADELLA ' Home 'Economic Club President 4 and Yice President 3 IIANNA, LEE EDDY Home Room Secretary 15 Home Room Basketball 1, 2, 35 Oil C n Business Manager 45 Senior Hi-News Business 3, 45 Mystery Play 1, 2, 35 Hi-Y Council President 3, 4, Vice President 2, 35 Speech and Dramatic Club 1, 2, 3, 4, CPresident 2, 3, 4j5 Latin Club 25 Magazine Campaign Business Manager 35 School Rotarian 45 One Act Plays 2, 35 P. A. System An- nouncer 3, 45 Senior Play 45 Chemislry Club 4: Debate Team 4. HART, BIARTINA Spring Presentation 3. IIECEDIJS, JOHN Boysf Intra-mural Athletics 1, 23 Student Council 43 Pep Squad 43 Xmas Card Committee 4. IIEPLER, WANDA LEE Home Economics Club 3, 4. IIICKMAN, JACK Interclass Basketball 1, 2, 3, 43 Magazine Cam- paign 3. IILAWATI, ROBERT EDWARD Boys' Intra-mural Athletics 1, 23 Student Council IIOLLABAUGH, JOE Alito Shop Club3 Shop Players 4. IIOLTZ, DOROTHY 2 L Spring Concerts Cvocal and instrumentj 2, 3, 43 Pit Orchestra 3, 43 Anything Goes 3. HUEFNER, JOAN Home Room Vice President 43 Spring Concert Cvocalj 1, 2, 3, 43 Girl Reserves 1, 2, 3, 43 Latin Club 23 9th Latin CIIIIJQ Pep Squad 2, 33 Xmas Card Committee 43 Magazine Campaign 33 Anything Goes JASIOTA, MARY Girls' Interclass Basketball 1, 2, 33 Senior Ring and Ein Committee3 Guidance Representative 43 Anything oes 3. JEFFREY, VIRGINIA Home Room Secretary-Treasurer 43 Mystery Play 33 Operetta 3, 43 Spring Concert Qvocalj 1, 2, 3, 43 Oil Can Literary and Photography Staffs 43 Girl Re- serves 13 9th Latin Club3 Pep Squad 23 Anything Goes 3g Spring Presentations 3. Girls' Quartet. Jrgalco, JOE 3 Freshman Football Squad3 Operetta 43 Spring Con- cert Cvocalj 1, 2, 3, 43 A Cappella 4. JOHNSON, HARRY Boys' Interclass Basketball3 Oil SL Gas Club 4. JOHNSON, HELEN Home Room Secretary 43 Spring Concert Cvocalj 1, 2. 3, 4 and Cinstrumentj 13 Girl Reserves 43 Etiquette Club 2, 3, 43 Pep Squad 23 Anything Goes 23 Spring Presentations 33 A Cappella 4. JONES, NIARILYN Latin Club 43 Etiquette Club 23 Anything Goes 3. KARASINSKI, SOPHIE Library Staff 2, 3, 4. KARNS, RAY Football Varsity 3, 43 Home Room President 43 Oil Can Literary 43 Hi-Y 4g Chemistry Club 43 Anything Goes 3g Varsity O Club 4. KENNEDY, RICHARD Boys' Interclass Basketball 23 Operetta 3, 43 Spring Concert Cinstrumentj 1, 2, 3, 43 Pit Orchestra 3, 43 Chemistry Club 4. KIFER, VIRGINIA LEE .Iunior Class Secretary3 Senior Class Vice President3 Home Room Secretary 13 Oil Can Literary 3 and Art Co-editor 43 Student Council 3g Spring Concert Qvoc-alj 13 Library Staff 2, 3, 43 Girl Reserves 2, 33 Etiquette Club 23 Amateur Broadcast 2, 3, 43 Make-up Committee 3, 43 Pep Squad 3, 43 Magazine Com- mittee 33 Senior Nominating Committee3 Junior Prom 3. KIFER, VIVIENNE 3 American Legion Award 13 Home Room President 4 and Secretary 33 Student Council 23 Oil Can Literary 3 and Co-art Editor 43 Library Staff 2, 3, 43 Girl Reserves 1, 2, 33 Etiquette Club 23 Amateur Broad- cast 2, 3, 43 Make-up Committee 43 Pep Squad 43 Magazine Campaign 3. KING, MARY THERESE Oil Can Business 43 Spring Concert Cvocalj 1, 2g 9th Latin Clubg Etiquette Club 23 Xmas Card Manager 43 Magazine Campaign Co-manager 3. KISKADDEN, JOE Home Room President 1, 3, 43 Student Council 23 Basketball Band 43 Operetta 23 Spring Concert Cinstrumentj 1, 2, 3, 43 Pit Orchestra 3, 43 Music Club Council President 43 Hi-Y 1, 2, 3 and Pres- ident 43 Amateur Broadcast 3. KITCHELL, DAVID ELTON 2- Spring Concert Cinstrumentb 1, 23 Hi-Y 2, 3, 4. KLAPEC, CHESTER Oil SL Gas Club 2, 3, 4. KRAFT, JEAN MARIE Director of Spring Presentations 3. KRUC, BETTY LORRAINE Oil Can Business 3, 43 A Cappella 43 Spring Concert Cvocalj 1, 2, 3, 43 Girl Reserves 1, 2, 33 Etiquette Club 23 Pep Squad 2. KULLING, ADELINE Girls' Interclass Basketball 33 Spring Presentations 33 A Cappella. LAUFFER, RUTH Library Staff 2, 3, 43 Freshmen Nominating Com- mittee3 Spring Presentations 1. LESLIE, MARY JEAN Oil Can Business 43 Girls' Interclass Basketball 3, 43 Interclass Volleyball 43 A Cappella 43 Operetta 4g Spring Concert Cvocalj I, 2, 3, 43 Music Club Council 23 Anything Goes 33 Chemistry Club 43 Speech and Dramatic Club 43 Latin Club 23 Senior Ring and Pin Committee,3 Guidance Representative 3, 4. LOGAN, ROBERT CALVIN Oil Can Business Staff, Photograph Editor 43 A Cap- pella 3, 43 Spring Concerts Cvocalj 2, 3, 43 Hi-Y 2, 3, 43 Chemistry Club, President 43 Speech and Dramatic Club 23 9tl1 Latin Club3 Pirates of Penzance Com- mencement Play 43 Il Trovatore, The Thespian Club 43 Spring Presentations 23 Interclass Basketball 33 Mystery Play 3, 4. LUDWIG, RODNEY Boys' Interclass Basketball 2, 3, 43 Operetta 3, 4g Spring Concerts Cvoealj 3, 43 Hi-Y 3, 43 Speech and Dramatic Club 3, 43 Spring Presentations 33 Any- thing Goes 33 One Act Plays 3, 4. LYNCII, JERRY V I Home Room President 3 and Secretary 43 Spring Presentations 33 Girl Reserves 1, 2, 33 Senior Play 4. McCASH, WILLIAM Oil Can Business 43 Boys' Interclass Basketball 1, 2, 33 Freshmen Football Squad3 A Cappella 3, 43 Spring Concerts Cvocalj 1, 2, 3, 43 Ili-Y 1, 2, 3, 43 Latm Club 2. lVIcCLlNTOCK, Cl-IARLES Oil and Gas Club 3, 4. IVICCOLLUIVI, JEAN Oil Can Business 3, 4, Senior Hi-News Business Staff 1, Marching Band 2, 3, A Cappella 2, 3, 4, Girls' Swing Band 2, 3, 4, Pit Orchestra 2, 3, 4, Girl Re- serves 1, 2, 3, Chemistry Club 4, 9th Latin Club, Amateur Broadcast 2, 3, Freshmen Nominating Com- mittee, Senior Play 4. l1IcDANIEL, MARY Senior Hi-News Business 1, 2, A Cappella 2, 3, 4, Spring Concerts Cvocalj 1, 2, 3, 4, Girl Reserves 2, 3, 4, Latin Club 2, 9th Latin Club, Etiquette Club 2, 3, 4, Pep Squad 2. McELHATTEN, MARY Girl Reserves 3. McFADDEN, JANE Interclass Volleyball 4, Home Economics Club 4, Etiquette Club 3, 4. , MCGILLICHUDDY, BETTY Interclass Volleyball 4, A Cappella 4, Spring Concerts Cvocalj 1, 2, 3, 4. McLANE, SUSAN YVONNE Home Room President 2, Student Council 3, 4, Inter- class Volleyball 4, Girl Reserves 1, 2, 3, 4, Etiquette Club 2, 4, Senior Nominating Committee. l1IcLAUGHLlN, EDWARD , Interclass Basketball. McQUOWN, TERRY Home Room President 3, Oil Can Literary 4, Senior Hi-News Literary 2, 3, 4 and Sports Editor 3, 4, Interclass Basketball 2, 3, 4, Hi-Y 2, 3 and Vice President 4, Magazine Campaign 3, Quill Sz Scroll 4. McDONALD, VIRGINIA Chemistry Club 4, Latin Club 1, 2, Etiquette Club 2, 4. MacLAUGHLIN, EMMY LOU Spring Concerts Cvocalb 1, 2, 3, Girl Reserves 1, 2, Latin Club 2, Pep Squad 3, Anything Goes 3. ' MAST, JUNE Spring Concerts Cvocalb 2, 3.. IWILD, FR ED Home Room Vice Pres. 1, Oil Can Business 4, Inter- class Basketball 1, 2, 3, Marching Band 1, 2, 3, 4, SpringYConcerts Cvocalj 1, 2 and finstrumentj 1, 2, 3, 4, Hi- 1, 2, 3, 4, CTreasurer 1, 2, 35, Chemistry Club 4, Amateur Broadcast 4, Guidance Representative 4. MILLER, BLAINE Auto Machine Club 4. MINTZ, DAVID Oil Can Literary 3, Senior Hi-News Business 3, 4, Interclass Basketball 3, Hi-Y 2, 3, 4, Chemistry Club 4, Latin Club 1, 2, Amateur Broadcast 3, Pep Squad 2, Senior Nominating Committee, P. A. System Announcer 4, Christmas Play 2, Spring Presenta- tions 2, 3, Senior Play 2, 3, '4. MOORE, FLORENCE MAE IIome Room Secretary 2, A Cappella 4, Operetta 2, 3, 4, Spring Concerts Cvocalj 1, 2, 3, 4. ' MORGAN, VIVIAN 1 Home Room Secretary 2, A Cappella 4, Spring Cop- certs Cvocalb 2, 3, 4, Spring Presentations 3, Girl Reserves 2, 3 QT:-easurer 25, Latin Club 3, Pep Squad 2, 3. MOTTER, DONALD ' . Student Council 3, 4, Oil 81 Gas Club 2, 3, 4, Xmas Card Committee 4. MOYER, MILDRED A Cappella 3, 4, Opcrctta 4, Spring Concerts Cvocal. 1, 2, 3, 4. IYIURPHY, J. PATRICIA A Home Room President 2, Senior Hi-News Business 4, Library Staff 2, 3, 4, Girl Reserves 1, 2, Speech and Dramatic Club 4, Latin Club 2, 4, Pep Squad 1, 2, 3, 4, Senior Play 4. MYERS, G. DEAN Spring Concert Cvocalb 1. MYERS, LAURA Interclass Basketball 1, 2, 3, 4, Cheerleader 1, 2, 3, 4, Varsity MO Club. NELSON, IVIARY ADA Student Council 3, Operetta 2, Spring Concert Qin- strumentj 2, Pit Orchestra 2, 4, Library Staff 2, 3, 4, Chemistry Club 4, Latin Club 4. NICK, SUSAN Home Economics Club 4. NICKLIN, BRYAN I Interclass Basketball 1, 2, 3, 4, Ili-Y 1, 2, Speech and Dramatic Club 2. NOVAK, FRANCES . A Cappella 4, Spring Concerts Cvocalj 1, 2, 3, 4, Girl Reserves 3, 4, Latin Club 1, 2, Etiquette Club 2, Pep Squad 2, 3, One Act Plays 4. PARKER, GAYLE Football 1, 2, 4, Volleyball 1, Basketball 1, 2, 3, 4, Home Room President 1, A Cappella 2, 3, 4, Spring Concerts Cvocalj 1, 2, 3, 4, Boys' Quartet 2, Music Club Council 4, Hi-Y 1, 2, 3, 4, Chemistry Club 4, Amateur Broadcast 2, 3, 4, Varsity O Club, Student Council 3. , PAYNE, RICHARD A Marching Band, Orchestra: Basketball Manager 4, Latin Club 1, 2, 3, 4, Chemistry Club 4. PEARSON, DAVID .lunior Class President, Ilome Room President 2, Football 2, 3, 4, Basketball Jr. Varsity 2 and Varsity 3, 4, Student Council 2, 3, 4, Oil Can Literary 4, Hi-Y 2, 3, 4, Chemistry Club 4, Magazine Campaign 3, School Rotarian 4, Junior Prom, Senior Ring and Pin Committee, Varsity HO Club Secretary-Treas- urer 4, Honorary Basketball Captain 4. PERTZ, BETTY Senior Hi-News Literary 3, 9th Latin Club. PFENDLER, DUANE Intra-mural Athletics 4, Auto Shop Club Secretary 3, 4. PFENDLER, ROBERT Magazine Subscription Campaign 3. PLISKA, INIILDRED J. Library 2, 3, 4, 9th Latin Club. POLDI, EUGENE Home Room Vice President 15 Intra-mural Athletics 1, 2, 3, 45 Machine Shop 3, 45 Guidance Representa- tive 4 POULSON, JOAN N E Interclass Basketball 15 Yolleyball 45 Spring Concerts fvocalj 1, 2, 3, 45 Etiquette Club 25 Pep Squad 2. POWIERS, FERN LUCILLE Home Economics Club 3, 4. PRICHARD, MARY Spring Concert Cvocalb 35 Speech and Dramatic Club 3. PULEO, CARL FRANK Oil Can Business 45 Marching Band 1, 2, 3, 45 A Cap- pella 3, 45 Pirates of Penzance 35 Pit Orchestra 2, 3, 45 fStudent Conductor 3, 455 Hi-Y 35 Amateur Broad- cast 1, 2, 3, 45 Pep Squad 3, 45 Boys' Swing Band 2, 3, 45 Tune In5 Amything Goes5 Commencement Play 45 Mixed Quartet 45 Spring Concerts Cvocalj 1, 3, 4, Cinstrumentj 1, 2, 3, 45 Senior Play 4. RAY, ARNOLD Marching Band 2, 3, 4. REESE, SIDNEY Home Room Secretary 2 and President 45 Manager of Football Squad 45 Interclass Basketball 2, 3, 45 Freshmen Nominating Committee5 Varsity O Club Vice President 4. REINING, DORIS Home Room Vice President 25 A Cappella 45 Spring Concerts Cvocall 1, 2, 3, 45 Spring Presentations 35 Girl Reserves 45 Speech and Dramatic Club 25 Etiquette Club 2, 35 Pep Squad 2, 3. REINSEL, ROBERT M. ROGERS, MARYLU Girl Reserves 3, 45 Home Economics Club 4. ROSE, NANCY . Home Room Secretary 35 Oil Can Assistant Editor 4 and Literary 3, 4: Student Council 45 A Cappella 45 Operetta 45 Spring Concerts Cvocalj 1, 2, 3, 45 Ensemble Groups 45 Girl Reserves 2, 35 Chemistry Club Secretary 45 Latin 25 Senior Hi-News Business 3, 45 Senior Annual Committee: 9th Latin Club5 Junior Prom Committee 3. ROSS, JEAN Spring Concerts Cvocalj 2, 3, 45 Etiquette Club 2, 4. ROSS, ROBERT RICHARD Auto Club 4. RUSS, RUTH Freshman Vice President5 Home Room Vice President 15 Oil Can Literary 45 Senior Hi-News Literary 45 Student Council 1 5 A Cappella 3, 45 Library Staff 2, 3, 45 Girl Reserves 1, 25 Etiquette Club 2, 3 and Presi- dent 45 Amateur Broadcast 15 One Act Plays5 Senior Play 45 Anything Goes. RUTHERFORD, KENNETH Stage Force 2, 3, 45 Marching Band 3, 4. RYCZKO, CHARLOTTE PATRICE Spring Concert Cvocalj 25 Office Girl 4. SARIPSELL, SHIRLEY A Cappella 3, 45 Opera 3, 45 Operetta 3. SCHELL, JOHN B. Football 1, 3, 45 Basketball 25 Home Room Vice Presi- dent 2 and President 45 Boys' Intra-mural Athletics 25 Ensemble Group 45 Machine Shop 45 Hi-Y 1, 25 Tradewind Editor. ' Student Council President 45 Hi-Y 45 Varsity O SCHELL, DIARY MARGARET Club. Etiquette Club 2. RFMAL Y, ALVIN SCHN EPP, TERESA MAXINE Oil SL Gas Club President 3, 4. REGLE Y, GRACE A Cappella 45 Spring Concerts Cvocalj 1, 2, 35 Eti- quette Club 2, 3. Speech and Dramatic Club 2, 45 Etiquette Club 2. SHARP, ANN RITCHI E, NORMA A Cappella 45 Spring Concerts Cvocall 1, 2, 3, 4. ROBINSON RUTH 9 Home Room Secretary 35 Oil Can Literary and Art 45 Marching Band 2, 3, 45 Ensemble Group 45 A Cappella 3, 4 CSecretary 455 Operetta 2, 3, 45 Spring Concerts vocal and instrumentl 2, 3, 45 Girls' Quartet 45 Girl Reserves Secretary 2 and Treasurer 35 Chemistry Club 45 Latin Club 25 9th Latin Club Sccretary5 Amateur Broadcast 2, 4. f RODGERS, ROBERT GRANT Football Squad 35 Oil 82 Gas Club 2, 3, 45 Magazine Campaign 3. RODGERS, EDDIE Marching Band 2, 3, 45 Boys' Swing Band 3, 45 Spring Concerts Cvocalj 1, 2 Cinstrumentl 1, 2, 3, 45 Pit Orchestra 3, 45 Hi-Y 3, 45 9th Latin Club5 Amateur Broadcast 35 Junior Nominating Committee5 Trumpet Trio 45 Don't Take My Penny 45 Tune In5 Pirates of Penzance 3. RODGERS, GLENN A Cappella 3, 45 Hi-Y 3, 45 Chemistry Club 45 IIome Room President 35 Tune In5 Pirates of Penzance5 Anything Goes. Oil Can Business 45 Pit Orchestra 1, 2, 3, 45 Ensemble Group 15 Latin Club 1, 2. 3, 4. SHERMAN, MILDRED Home Room President 25 tudent Council 15 Spring Concerts Cinstrumentl 1, 2, 3, 45 Ensemble Group 15 Pit Orchestra 3, 45 Music Club Council Secretary 45 Library Staff 2, 3, 45 Girl Reserves 2, 3, 45 Chemistry Club 45 Speech and Dramatics Club 25 Latin Club 25 Etiquette Club 1, 25 Amateur Broadcast 45 Pep Squad 15 Spring Presentations: Mystery Play 3, 4. SHIELDS, JAMES EDWARD Home Room Vice President 45 Oil Can Business 45 Operetta 3, 45 Spring Concerts Cvocalj 1, 2, 3, 45 A Cappella 45 Spring Presentations 1, 2, 3, 45 Hi-Y 1, 2, 3, 45 Stage Force 25 Xmas Card Committee 4. SHOOP, NAOMI Home Room Secretary 35 Etiquette Club 2. SIDIPSON, JOE Senior Class Treasurer5 Boys' Intra-mural Athletics 1, 2, 3, 45 Interclass Basketball 35 Student Council 15 Hi-Y 45 Senior Nominating Committee. SLATER, BETTY JANE Spring Concerts Cvocalj 1, 2, 35 Etiquette Club 3, 45 Pep Squad 3. SNIIDER, DON Home Room President 4, Interclass Basketball 1, 2, 3, 4, A Cappella 2, 3, 4, Mystery Play 3: Operetta 2, 3, 4, Spring Concerts Cvocalj I, 2, 3, 4, Hi-Y 1, 2, 3, 4, Amateur Broadcast 1, 2: Pep Squad 3. 4, Prom Committee 3, Guidance Representative Anything Goes 3. SDIITH, PATRICIA RUTH A Cappella 4, Operetta 4, Spring Concerts Cvocalj 1, 2, 3, 4, Etiquette Club 2, Amateur Broadcast 3. SDIITH, PHYLLIS FAYE Home Room Secretary I, A Cappella 3, 4, Spring Presentations 3, 4, Spring Concerts Cvocal and in- strumentb 1, 2, 3, 4, Speech and Dramatics Club 4, Etiquette Club 2, 4, .Anything Goes 3. STAIILMAN, RUSSELL ' Interclass Basketball 1, 2, 3, 4, Oil 82 Gas Club 4. STOUDT, JEANNIE LOU Senior Class Secretary, Home Room Secretary I, Oil Can Literary 4, Senior Ili-News Literary News Editor 3 and Editor-in-Chief 4, Quill XL Scroll: Spring Concert Cvocalj 1, Library Staff 2, 3, 4, Girl Reserves 2, Pep Squad 2, Spring Presentations 3. STOUGHTON, RICHARD Varsity Football 3, 4, .Iunior Varsity Basketball 2, Varsity Basketball 3, 4, Oil Can Literary 4, Varsity HO Club President 4, Hi-Y I. 2, 4, Chemistry Club 4, Honorary Football Captain 4. I STRICKENBERGER, RLTH IRENE - A Cappella 4, Spring Concerts Cvocalj 1, 2. 4. SWACHA, FRANK RAYMOND Co-literary Editor of Oil Can -1, Senior lli-News Liter- ary 4, Oil SL Gas Club 2, 3, 4, Pep Squad 4, Secretary ol' Guidance Representatives 3, One Act Plays, Trade- vvind Editor. SWOGER, PATRICIA ANN Interclass Basketball 1. 2, 3. SZABAT, JOHN FRANCIS 9th Basketball, Ensemble Groups I, Machine Shop 2, 3, 4, Magazine Campaign 3, Prom Committee 3, Guidance Representatives 3, Tradewind Editor. TAFT, RAY Interclass Basketball 2, Freshman Football Squad, Machine Shop 2, 3, 4, Amateur Broadcast 2. TAMBURINE, JULIE Home Room Secretary 3, Senior Hi-News Literary 4, Spring Presentations 3, 9th Latin Club, Etiquette Club 2, 4. TAYLOR, PI-I YLLIS Home Room President 1, Marching Band 2, 3, 4, A Cappella 4, Spring Concerts fvocal and instrumentj I, 2, 3, 4, Trumpet Trio 1, Pit Orchestra 3, 4, Music Club Council 4, Girl Reserves 1, Chemistry Club 4, 9th Latin Club, Girls' Swing Band 2, 3, 4 CManager 3,4j. TEETER, GEORGE Oil Can Art Staff 4, Interclass Basketball 1, 2, 3, 4, Gymnastic Squad 1, 2. 3, Marching Band 2, 3, Spring Concerts Cinstrumentj 2, 3, Hi-Y 1, 2, 3, 4. TOCK, PAULINE A Cappella 4, Operetta 4, Spring Concerts Cvocalj 1, 2, 3, 4. TRZUSKOT, HELEN LOUISE Girl Reserves 2, 3, Home Economics Club 4. LDICK, FRANK Interclass Basketball 2, 3, 4, Student Council 2, Ili-Y I, 2, 3, 4, 9th Latin Club, Vice President of Guidance Representatives 4-. LLRICH, MARY Spring Concerts Cvoealj 2, 3. IQREY, LOUISA AIAY Oil Can Literary Co-Editor 4, Senior Hi-News Editor- ial Editor, A Cappella 3, 4, Spring Concerts Qvocalj 1, 2, 3, 4, Chemistry Club 4, 9th Latin Club, Latin Club 2 and Vice President 3, 4, Amateur Broadcast Ad- vertising Manager 4, One Act Plays, Speech and Dra- matics Club 4, Advertising Manager for Donit Take My Penny 4, Pirates of Penzance 3, Il Trovatore 4, Anything Goes 3, Tune In 2. VANDENBERG, EDWARD Senior Class President, Home Room Treasurer 1 and President 2, Varsity Football 3, 4, Basketball 2, 4, 9th Basketball, Student Council 2, Oil 81 Gas Club 2, 3, 4, Hi-Y 4, Xmas 'Card Committee 4, School Rotarian 4, .Iunior Prom 3, Senior Ring and Pin Committee. WAGNER, KERETTA I Oil Can Literary 4, Xmas Card Committee 4, Maga- zine Campaign 3. WATTS, CAROL ANN Oil Can Literary 4, Mystery Play 3, Girl Reserves 2, 3, Latin Club 2, Etiquette Club 2, Pep Squad 2, 4, Spring Presentations 3. WEAVER, MARY JANE Oil Can Photography and Literary 4, Senior Hi-News Literary, Spring Concerts Cvocalj I, 2, Girl Reserves 1, 2, 3, Speech and Dramatics Club 2, 3, Spring Pres- entations 2, 3, Thespian Club 4. WEAVER, MIRIAM Girl Reserves 1, Speech and Dramatics Club 3, Amateur Broadcast 3, Pep Squad 2, Spring Presen- tations 3. WILTANGER, WALTER Gymnastic Squad 1, 2, Auto Shop 2, 3, 4. WOLBERT, RITA , A Spring Concerts fvocalb 1, 2, 9th Latin Club, Etiquette Club 2, Spring Presentations 3. WOLFE, RICHARD Ex Libris Oil SL Gas Club 2, 3, 4. WORK, RUSSELL A Hi-Y 1, 2, 3, 4, Pep Squad 3. WORKMAN, ANNA NIARIE Camera Club I, Speech and Dramatics Club 2, 3, Etiquette Club 2, Pep Squad 2. WRIGIIT, ELNETTA SYLVIA . Latin Club 2, Etiquette Club 2, Spring Presenta- tions 3. XVYDRO, HELEN' Library Staff 2, Junior Prom 3. YASHINSKI, TONY Machine Shop 2, 3, 4. ZIEDIBA, DIARY Girls' Volleyball Captain 2, 3, 4, Girls' Basketball Captain 2, 3, Home Economies Club, Spring Presen- tations. . 'nooooovn-soo-no - -n- ooooooo-mobo PATRONS H. S. ROSE DR. PAUL ROBERT CURTIS J. D. TRAX, ATTORNEY H. T. PARKER, ATTORNEY DR. AND MRS. WELTY DR. G. V. KOHLMAN DR. J. H. FOQUET DR. W. McANDREWS MRS. D. J. CAVANAUGH DR. H. C. KENNEDY SKELLY 81 MOGILOWITZ DR. D. v. UREY DR. JOHN M. ASKEY DR. c. T. KERR .JACK HEYISON MR. AND MRS. w. J. ANNA SLASH sf ACE B AND RRUGlE LES sr SLATS THREE 1v1usT-c1T-TERs DR. ERIC HERNBLOM JANEY AND EDDY JEANNIE AND LOGlE - - -ooooooooc-44-oooc-of-eeaooooeoa-oc-1-04-4-1o - - - - - A - ooooooc-c-un-A-sp0c-+c-4-o4- -:rn-M-r-rrm-x-m-no-x-a-so-w-x-m-N-n-1-1-4-n-rm-1-n4,-a-x-:-+-r-,ln-www-x-r-r-v-rx-mlm-w-x-nwo-no-r-n-rx'M-:ww-x-x-L-n-xon-rvvw-x4-1-m-N-poo-x-1-rm-n-n-x-ro-r-N-N-x-1-x-n-r4-r-n-n-x-rx-io-rv:-no-x-Q-N-x-no: 3 9 G 8 5 0 0 9 Q 1 . ! a 7 -3 Y Q Z e I 9 7 0 3 4 5 9 . 9 A , . Z R A 9 6 Y Q v . 1 A Y 6 3 4 9 F . 4 2 e 9 2 ' 6 z I 9 3 - 0 -1 . 9 A 5 6 2 3 v Q Y A 'f + E' 2' o ' Q 9 e 2 e . 2 6 2 3 2 Q 5 2 2 e 3 3 Q 2 9 5 S e 2 3 Y e ' Q 9 o v 4- 3 1-Q?, ' w 2 9 5 2 e + Z 1' e V 6 9 ef W 9 9 e 3 4 Q 3 9 e 2 2 9 6 9 9 9 4 V 9 Q + 9 1- 1 4 3 e 9 3 1' 4 Q I I . 0 a 2 - 9 V 9 9 8' 9 e Y 9 ' 9 2 6' -2 2 9 4 Z e 2 2 5 e 2 ' 2 9 is .-lj, 4 G E . 0 A 9 4 2 o 5 3 9 S 2 Q v e '-5 'Z ' . e 5 ur pecla ties 3 O S ' I ' 2 1. 2 0 A Q HIGH GRADE I TERIOR I 9 + 9 4 9 e 2 FINISH STAIR WORK + e ! 2 3 Q + AND STORE F RONTS 9 e 9 e 9 A ' e 9 a 9 e 9 e 3 2 9 6 g e 0 2 9 e 2 4 9 a ' 9 3 2 2 e E I 3 9 e 5 o G 2 0 V e 2 o , - , - - g 9 6 2 Z 2 7 2 S - - 4 + 2 9 e ' Q 9 e v 8 z TILE BLOCKS - PAINTS - BRICKS - GLASS , Q Z 0 1' 9 -e 1 4 1 o '4 1' 9 e 2 9 V 1' 9 6 V O 0 ef 9 9 5 6 9 e 3 Z V 1' 9 fa Y 9 Z . 4-M-4onu-Q-4-1-a.m-4-444-4-c-4-Q M-4+ 1-404.ai-4-1-ul4-4'on4-4-4,1-N-r-1,QN--Q4-ur1-N-N-4-Q49+4-1-c-4-4-c-Q44-of-was-e1-e1-M-c-N'444-QN-1-1-N-1-4-44-M-0oc-uvu-4-+4-1-c-4-eu-1-clc-c-4444-c-444-c-cfQfe-41-4-4-ure-u.4-uw4-o -30-r-n-no-Q-n-naoao-x-r -fo-n-1-so-rn-M-n-ma-x-M-n-x-mv-x-M-x-1-no-rn-m-r-N-n-www-1 ff-xff-M-na-novo-r-yn-no4-N-xv-mov-w-no-u ooo-x-r-rn-n-noQ-wo-x-noooooo-no-x-Q-moo-so +4-sa-r-xlnmooom ' o '? V e 9 . ? ' 6 Q e Y e Y Q V E 9 e ? e -r 4- V .Q 0 o 3 2 e . e . 9 2 . Q 3 v e 3 e Q e e 2 Q Zfne qaancf Seniafzd '? e ' e 5' e v Q v Q Y A -r 6 V v Z 1 e 1 e . 9 S v Q 1 e 2 e 6 '? e Y 9 ' e ' e be . Q A Q . + 3 W e 9 e Y e ' e if n Y 6 Y 1' ' e ? e ? 9 e 9 e ' e ? e T e ' e A 9 'f in 6 ' e 4 e '? e v '? 'r 6 ' e 9 . 2 ef . o 5 2 Y Q Y B ' z 6 1 E 2 e - : e , e 5 Z Y 2 5 4 S e ef e fa e va . e ' 4 Q e e E 0 Z e ed e e 2 Z Q 3 3 V I 2 5 . B 5 Q ef ? Z Y 1' ' e E g Z + 3 2 1: 9 ' 4 9 9 I v v Z . + -f 4 ' 6 e A 4,45 ON 'OR MOVING- ' 4 ff 712613 60. 652223 DAY 'ew 4' . '? e V e- 9 e 9 Q 'F e if e 4' e o . :rc-eau-m 1-c-c-u-4-c-c-c-c-c- 1 of-1-4-c-4-c-1-eu-4 4-Q-4-u-u-4-4-1-4-+ 1-1-1-M-c-1-of-c-c-4' 4-c-c-4-1-ef-1-ec-4-+ u-4-x-4-4-c-4-1-c-c-4-eu-ec-4-c-1-ofc-1-4:-1-cwnoeeooc-+4-c-4-4-c-ec-c-4-u-4- 1-c-4-4-ou-4-4-c-c-44 1-4-c-c-oc-1-c-1-c-cw 4-M-eu-1-M-oc-4-4 anvn-n-no-s-n-nornnr so 4 xr-n-or n runny rnnnnr nnno or rorr-1-no-rn-rv-:-x-xnxnxnf-vnxnxnny-nnnnnr xv :nun-:nr nu-no-r-:eo-rw:-nxr: PURITY MILK CQMPANY .:.oc.4.4...1- 6 4-4 4,1-M 4.4.4. +4.44- PERF ECTLY PASTEURIZED MILK A ,.1.,.4.,.Ms 1' 4.4. A e 5 PHONE 379 - 3 ? z 9 3 ' Compliments of A CONGRATULATIONS-CLASS OF '45i Q BROWN'S BOOT SHOP 5 . E f 211 C t St t 5 JEAN FROCKS,INC. Q ww we 2 1' e 9 3 2 5 The Little Money Dress Shop Oil Cityas 5 9 e I Popular Family Shoe Store O 9 ' 5 .W....,,....,.........,...,..,.,.....,.,.M...,.,...,...,.....,.,....,.....,.,...,..,. M .,. 2 2 0 2 Q E CONGRATULATIONS '45 Y g Q 3 Best Wishes come true, car-wise, with our 3 3 Z '3 complete. regular service and inspection. 4.411-1, 0-no -x 0-1 e , Good luck follows those cars using our 2 Pr lu el and Pm h e 5 o . . . . A ' jj Y- ' 2 highest quality batteries, tubes and tlres. g Oc L S C M rs 3 2 More power to you is certain in a car power- 2 2 4,0 ed b Pennzi 0'z1s and Pennzoil motor oil. Y is on no-2 -1 + . . a Of You'l1 0 far in an wr b seeine' us tocla ! Q ' E g y 1 y b L y 5 2 9 9 . 3 . . 2 Q E George Krug - - Seneca Si. Service Station C R U D E O I L + z 3 ' 5, 353 Seneca St. Phone 1703 Q A gn ,N,nNnNMHNNnNW,NNNNM,M,,H. NhnN.NNgMNMuM,nNMn,MwmswusewsonsswoswwwuwhM,.Q 9 Q 2 2 S me-ec-4--sou-4. xo -n .v 4.1. -1 0 I P D 0 Z P us .. I I E A . C 'I I Q Q 1 - 9 ? e a 5 N Q 6 I W 3 v :Q-K4iCCl4 llllllilfl fCfl9ClKK I C 0 CI I l fl K 1411111614-CICKCCIKK C liffifllllllilll KICCKCIIIKCQKII f 'KO C CK!! if C41 41111111111 134 4-ww 0 9 ? I 9 v 9 9 9 9 9 ? Z 9 v 9 9 9 9 9 9 9 9 9 9 9 v 9 9 9 Y 9 9 9 9 9 9 Y 9 9 9 9 '? 9 9 9 9 9 ? v Y 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 '? o-my E Y 9 9 ? Y 9 0 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 V 9 9 9 9 9 9 v 9 9 9 9 9 9 9 9 9 v 9 9 9 9 9 ? 9 9 fa 0 Q 6 E 9 4+ ,. e 6 IEDWARD W. WALLACEQ 2 2 Books - A Statio1Ie1y 2 Dry Goods 5 OFFICE EQUIPMENT Ready-to-Wear , 4-e r 5 ' 2 9 . . . 2 2 Crreetmg Cards Z Rugs, Carpets Q + 2 9 L 5 , z I 3 KODAK5 , A u g , Lmoleums g g 4 9 , x e ' S ATIIIIQIQOII Bldg. 42 Seneca St. 2 5 ' R Q 3 Shoes 'E 3 w9N.,-n-N-S-w-n-m-rn-w-Nnf,y-nn-N any-rrnrrrrrrrrrrvvxrxxrrxrrasr 1 e E 3 . . 4 3 5 Qomphments of E 9 5 2 oo RELIABLE RETAILERS 1- Q :- -wr A WELSH RADIO SHOP , A 2 'gf Smce 1886 f 2 ' ,,,.,, , ,..,,.,, .,,,, . ,.,., ,,,,,.,.,, mm 2 Q Compliments 5 5 1 2 2 of 3 WELKER 81 MAXWELL 00. 2 5 KEI.LER'S IVIILLINERY 3 5 2 E ..... .... ....... ...... .... ........ . . . ..... , ..... ........... ..... . ....... .... 5 COMPLIMENTS OF 9 ' E i 2 I WITH A COMPLETE STOCK . OF HARDWARE and HOUSEWARES 3 2 : SPORT SUPPLIES Q 2 9 . 3 27-29 OIL CITY, A SENECA ST. PENNA. i 6 ' e 4 e 4 uuccuucuucuuuuu cucuuuuccu uuzcucucucuuuuuucczuocuucuucuuuunuuna neu c uuuu-occuuurenumuuucc-4-on-t 135 suv-yn:nnnnnnnnnnrnnnnnannvvnn nnnnunrnnnynnnnnnnnnnun nnunnnnn,unnnnnnQxpnrnnn-n-n-n-ro-1-nf 9 6 4 A v E Best XYiSheS 5 E : , . v A HENRY F BOCKMAN f : E - : E PAUL OSSOFF A I O A 3 E Trucking Service . E The Only Oil City E ' I 5 cm City, Pa. 3 A R M Y S, T O R E 2 5 v ,, --w- -- e 4- , 3 2 I 2 E 2 E E 1 5 . E 3 KATHRYN GENEVIEVE SHOP TfffH11Hf1lS f f S 5 . 2 5 Q I G 5 Chl Lxty E .3 IZXCILISIVC Laches Ready-to-XX ear 2 Q 3 3 3 v 4 l 5 A Cleveland IDLIBOIS 5 9 . E S 2 E Phone 3130 ll6 East Flrst Street ' E E E s 2 2 2 g E E 3 ' 5 ,S,,,,.,,,,,,,,,,,.,,,,,,,.,,,,,,,,.,,,,.,,,,,,,,. ,,,,,,..,,, ,.,,.,,,,,,,,,,,,,,,,,.,,,,,,,,,,..,,,,.,,,..,. ,,,,.,,,,,,,,,,,,,,,,,,.,,,,.,,,.,,, Q S E f 2 CONGRATULATIONS, GRADUATES! S e 14 E. FIRST STREET 217 SENECA STREET G v , '- A THE BEST IN ICE CREAM AND DAIRY PRODUCTS 5 QTHARP MOTOR SALES? Compliments N A S H C A R S E Q M A C K T R U c K S , E 0 A 5 oi 5 3 Also a Safe Place To Buy or Sell 5 Your Used Cars E GOLDBERG AUTO PARTS CO. f . 5 Phone 581 12 E. Front St. nuuuuucuauuucuuuuuuuucuuuunu uunnuuuuuccucocuuxuueuuuuun uuauuuuuccuuu ucuuuuuunuunun 1 O o e oo-noooo-1-no-n-no-x-Nxnxononnonnrnnnnnnnnnnnnnnnnxsrnxnno-1-rrrrn-rmy-:onnnnnnnn-n-rn-n-mxnunnnnznnrnnrrxnnnm-no-x Y Y 'f Y A o 9 Y Y Y ? Y Y A '? v 0 A A Y Y Y 1 Y Y a ? 'f v v v A v A v V v w Y Y Y Y v ? Y Y A A '? A e A v 0 A v Y 1' v o i' 3 Y v + A 6 o 9 A e A e A A 1 0 A v v A o 0 A 4 1 Y A 0 5 4 'I' Y Y v Q Y Y Y Y v e 9 A e 9 5 Y v Q ? Y 1 Y A v A o A v A v v v s A a v 4 e o v Y v 9 v e 6 '? Y Y Y v A A v v v A A v A v e v A v v v A E' Y 3 Y v E' 3 Y A ? .1 9 Q A v v v v v 0 A A v 1 v A v v v A A A v o A v A v A v v A A A v v A A A A v v v v .- v 4 A e A A A A A QRTQN 5 ECKERDS A A A A A BILLIARD PARLOR VVHERE You GET THE LATEST AND HOTTEST DOPE 16 Seneca Street A A ON SPORTS : Five Newly Covered Tables CANDY AND SOFT DRINKS 4 A A A A A A A O ' e 9 e A 2 ORIGINATORS OF REASONABLE Q A e A A GO TO NORTON'S AND E MEET THE SHARKS 2 DRUG PRICES e A A e A A A u-ucccccoocuauuuuuuuucunuuucuuu uuucuu uucnc:neuuoc-oc-1-x-ec-1-4-Q-c-1-c-4-4ufuuafuuuuuucuua:uucuuucucuuu-4-4-M-Q BEST WISHES TO THE CLASS OF 1945 Esso Dealer- W. E. MURPHY ED. CASEY GASOLINE ALLEY MCCLINTOCKVILLE eauuuuuucucuuccccuuucuuuuauauuuuuuuuuccc4ucuuuuuuruucuuuucaA14Auuuuuuucuuuu4uuuuuuucuuuuc 9 e A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A e A A A A A A A A A A e e e e ef A 6 e e e 9 6 A A A A A A A o e A Q A e A A A A A e e e e E 0 e e e A A A A A 9 A e A A A A 9 A e A A A A A A A A 4' ef e e Q A A A A A A A A A A A A A A A A A A A e e e a 2 A if 4 2 l- e 9 a ef e A A A A A A A A A A A A A e A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A e A A A A A A A A A c 1-1 1+-1-1-1-1-1-1 1 1-1-1Q-1,1oo-1-11-11-1-1-no--1-111 1 1 1 1 1 1 1 1 1 1 1-1 1 1 1 1 1 1 1 1 1 1-1-1-11-1-1-1-141-1-11-1-1-1-1-1-1 1 1 1 1.1-1 1-1.141-1-1 1 1.1-1 1 1 141-1 1-111-1 1 1 14 1 141 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1-1 1 1 1 1 1 1 1.1 11-1+-wg 4 e e 9 . A. - o Q. Ice Cream Sundaes - 5 CONGRATULATIONS TO THE ' S Compliments of ' ' ' A CLASS OF 1945 ' WEST END FAMOORE STDRE f E 2 Mrs. Aldine Adams, Prop. . - 0 ? v 3 if lOO6 'VVest First Street Compliments 9 4 Sodas Candy of f 5 5 2 2 3 4- gcomplimentsoft THE MDOSE CLUB 3 ' e Local No. 78 3 9 e F R E D B R I G H T ' S 3 5 , I N S U R A N C E 5 A ' 2 2 ' Beers Building Phone 5'77'G Sycamore Street Oil City, Pa. , 2 2 I Q 4 QI K E E P F I T 3 if E 2 Compliments Q E 2 2 8 AMA 2 . 9 2 A . 2, 9 B 0 w L 5 ? 2 ' 5 2 S K R U B Y ' S I N N 3 2 ive- 2 2 ff 6 i A ' E 5 770120,-D!-DOD!7D!DDb!3!D 2,737 D!! DDDDIPDIDDDDD 7D!DD!!DlDD! 2 z A , ooo:- -1 3 PARTIES AT 5 SOUTH SIDE PHARMACY Z 4'-H J. P. SHEVLIN JACKSON'S . THE CRexalUl STORE i 3 RECREATION CENTER 22 East First sf. PHONE 900 5 c-c-c-c-c-c-ou- E 6 ff e e- e e A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A ev ef e e e 1.4 e OO A-0-1-1-D 1- e OO vs 1 E' e A A A 1 A A 4- A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A 1 e-4-c-1-4-ou-+or-1-M-u-N-4-4-4'ee-4-avuvc-4-N-4-+4-4-u-M-u-1-4-4-Qou-N-N-cu-1-41-u-4-4-1-1-4-uw-+ ooc-c-c-+o+4eeeeeeeec-1-rooo-04-of-c-ee-4-1-+004-c-4.mu.4.uw 1-c-N-4-f ou-coax. ovu-c-QN-4-4eu-4-N-c-1-1-u-eooeoeafe 5-4-+4-4-44-QN-M-411-4-ee:-eu-4-on-a-4 u-4-+4-1-Q-1-4-1-cw ee:-4-4-:vc-e-c-4-ease C L A R K ' S D0-NUT SHOP -x-wx-1-J-1-rr-1-r-rx-9Ar-r-x-1-1-p-1-rr-1-2-1-r0-x-r-1-2-rr-rx-x-2-n-y-1-Q-2-soo-r-rr-1-r-x-so-2-L-xr-9-r-x-1-Q-xo-1-1-ya-D-rx-1 , . S o 1 v ? v 1 v b v 9 Q ? 5 Z a e o a 0 w o Q 2 e o 0 Y -1 9 Q '? 5 I i 0 ? v 6 9 -1 E v a o o 9 9 Q 9 e o 0 0 Y wrts-r-x-1-no-N-N-N-1-n.wooou9 ro -rao-n-ye-r-no-.n-no-xo -v-1-w-x-no-1+ fa Q s a a '? Y Y -4 1 Y 'f Y v '? v s '? 1 Y v e 1 Y v e o Y v 1 v Q o o 9 Y Y v 1 Y v 1 Y v e a o a e ? v 4 o S' 1 Y v 1 1 1 -1 + 1 Y v 1 1 v Q 1 v 1 v i 1 CDMMUNITY MARKET FOOD SlJIffIALIS'IlS 15-17 Center St. Phone 921 HARVEY FRITZ Quality Jewelry and Photography Supplies - Oil City, Pennsylvania v-arr-rm-n-xfn-rvs-rm-rn-n-r-r-n-4-x-rn-n-:-m-rn -1-n-r-r-m-x-1-rw -r .x-no-:bm-n-x-r Q-no-n-x-r-N-r-rr n -x-x-rx-no-M-N.: rx-r-no-rw-1-N-y -s -x-,Q-rr-1-r-1-rw -1-x9-no-x-x-no-x-+-no-rr-N-r-1-n -mln-rn-N rm 4-no I I 8641 Wu ,, TO THE CLASS OF '45 VE ETIA DINING R OM Italian Dishes and Steaks 9 ,East Front Street Oil City, Pa. on-4-+ eu-c-4-M-of-of-+oc-N-4-4,1-1-c-4-of 4-c.ou-c-c-1-4-4-1-4-c-u-c-e1-N-c-4-4-+4-me-1-1-4-c-1-on 1-1-4-1-c-4-M-oo '? . G E 9 9 V 9 ? 'f Y Y ii- . 0 5 0 O 9 i---11 W 9 Y 'f Y Y Y Y . 0 Y . ? v 9 Y Y .- Y Y . 9 9 4 9 0 1 T E' . ? 1 . 0 Y Y 'f .. 9 9 V ? v W W 9 9 6 Y . ? Y .,.,..-,-H+,-,-M-.N-,.,.,f..w.,f.f,M..-,.1 o Q gg ,.,......,+,....., ..w.,.,..., -1-xao-r'moo-a1-n-2-woo'waa'Moo-rvova-no-xvooo-o-ooo-n-r-x-ro-sooo:-1-n-r-noooaoo-x-so-9-x-aw-r LEVINE CLEANERS Call Phone 3104 302 Seneca St. Oil City, Pa. ci4'ou-oN-oe4-M-4ec-QN-c-1-1-Qee+1-4-4-u-u-N-4-we M-c4-0u-u-c-4w4-c-c-M-4-M-1-c-cocoa-u-:lu-1-4,41 139 E 1 v 9 9 6 1 1 1 Q 6 9 1 1 . o 1 -. 6 0 9 1 1 Q 1 1 1 1 1 1 1 Z 1 V 1 v Y . 0 Q '? 1 1 1 1 1 . ? v 5 4 1 1 .. 1 1 1 1 v 0 Y 1 1 1 1 S 1-1-,MM-rn-1-1-,-1.104-N-N4.1we-H-no-N-1-1-1-,+-M-,w-nw-NV,-,M-1. ooo-9+ 0on-zo-a-ya-r-rua-rn-n-:ao-M 4-mmm -no me -na-14 ooooooo ooo-no u-,ooo 1 no -:oo oo-no-a 0 -x-:oo -no on oo -no-ma-x ao-1 vw-waoo-:ao-x -no-no-za.:-x 0 -1-1o-x4-mInon-za-n-n-m-now-rw ONLY THE BE T I GOOD E OUGH USE MOTOR OILS AND LUBES WOLFSMIHEAD I woLF's mann on nsrmme cot, mc. OIL CITY, PA. - v - - - - - - - ' V - A - ' - - -n-moo-na-r-p-x-n'm-no-nm-r -:ooo-no-rm ' ' ' ' ' 'M' ' ll REMEMBER. . . R SUPPORT WWW V W if Y X If fl BUY WAR BONDS - - STAMPS Congratulations to the graduates of 1945 ARMSTRONG - COLLIER, INC' 4-1-1-eu-1-1-c-c-44 oc-N-cl4-oc-no4-on1-1-4-u-eM-4.4-4'hu-c-1-u-noc-4-4-4-4-on-Q-x-1-c-1-eoou-4-4 Q 1 c 140 0 ? v v M ao ,. ,. om- 141 Imun-eu-an-ww:-4 u :vue-4-M 1ew-non-u-uz4u+Qou-+4-een-M-vu,uu-1-nf -ou zu Nu4u N e 4-1-4 4-M-M-u ua 1uwu-N1-eu-4-4:-M-M-4M-44-1 Qmrox-New-Q 4-Q-M-4 :vu ou-4.4-Qu-u-4-u u- +4-.neun c 4 an new-1 1-Qu-emu-u 1-4-Q44,eMu4-N 4-400.004-eq, .. 2 O 1 I 8 o 9 9 2 9 e 3 2 . . I ' Z g + e 1 0 3 H n 1 3 O 3 . 9 1 . L11 O : 0 ' Z ' . 0 z Q D-4 W , 2 rl a e P1 I : w w 3, 1 . 2 O I z U V1 3 I W i 2 3' :E w Z 1 A U3 P .. 9 Q v ' W ' 1' v e 2 -1 9 2 F U P I . 9 v ? V 2 Ib 4 ,.. : F1 00 : . . U2 3 e M Q 6 V 2 y 2 O : + V1 I 0 P11 0 2 i rl 3 ' - : 2 -. A 0 '11 I r-1 -' g r-4 9 - L ,.g 75 I A ' 9 A UI o A r-4 v Q H .5 2 ' 2 4 'U U1 3 2 :la ,-1 3 2 ' S 5 e 2 m FU 2 2 F1 3 : F1 + - '11 ,..l I 4 lv ' O Q ' . .. Z U3 C: I . 5 . 2 ' Z . ' Z 9 M B wa . r I-3 A I 3 r-1 Z 5 5 U: + 3 F1 n-1 + Z U 2 A I 4' 0 ' U ' 9 A Z 9 ' P4 U ' F v A 9 2 C: 'PU 3 an Pa P11 0 2 3 2 m Z , O ' 71 ' 2 3 6 fn o 'E 3 g 1 ' E 9 6 O A ir A 0 . 4, A 0 e al 1' 0 2 3 , . + 5 . :,,,,,,,,,.,,,,,,,,,,,, . oo so nf ooaooo-no so-1-oo-vrooooo-pro-.v 9-noooow oowoo-1-rx-so Q- M' o-L-.s-rx-xr vb n 9-rr amos-a oo-,v an-ly 6 Q o 9 9 v A -. v v v v v v v v A v v A v v v v -1 v v v A v v v v v A 1- v v - A v v Q v v -1 v 2 v -1 v v Y Y Y Y Y v V 0 9 9 9 9 v Y v ? v 0 V v '? Y D? Y Y Y v -f A u v v A 1, 9 v 1. v v 1- v A 1 v v v A v v v v v v v + v v A - A - v v 4 v A -. A v A Y v 9 4 0 V 0 9 9 o A 1- ? v -a a a 9 v 4 v v v v 1-114-1-111'1,1v144we1-1-1-010001-1-1-00 1'-oc-1-11-1:-1-14-14-1111-1-+1111 4-1- -1-+11-1-1,1-1-1-11-of-1-111-41 1-1-1 -1-o 14-oo-ec-01,1-oc-11-4-1 -1-oc-o -1-01 -1-1-1-1-11-1-1-Q01-4 +101-e1.1.1 one 01-oo -041-41-1-1+ 0111-1- .oc-1 -1-1-111,114 1,1-11-1-1-1-01-1-1-on -eu -1-0111 - 1-1 -11141-one-A014-1,m1voo1-1-1511-1-111-e1 1-eo -1-1 E THE RIGHT KIND OF ANY KIND OF- NSURANCE RS Established 1873 NATIONAL TRANSIT BLDG. aax-no-r-x-na-n-nnxnnonnonanvnnnnrn-n-nnrnnrrn-urn-A-N-rr ROOFING and SIDING JAMES A. MARTIN Oak Road, Hasson Heights --rr-1-9-x-x-no-no-1-x r r x x r x r r so 1 A N A r x N r n 1 y x 1 A r 1 r rr no 1 r x r-.v-no-nou-x-wo-rr:-no-Aa Compliments of JERKO DAIRY 1-1-1-1-+01-1-1-1-1-11-1-1-1-41,1-1-1-1-1 1-111-1-AQ1-11-1-1 1 1 1 1 1 41 1 1 1 1 1 1 1 1 1 1 +1 1 1 1 1 1 1 1-1-1-1-AQ1-1-n-1-1+ 6 4 4 Q e e e e o e e e 4 I 6 e e 0 9 9 e e e Q 6 4 e e- e e e e e e 4 0 e e e 4 e A 0 4 4 A f.- A A e 0 1- e e 4 A 9 9 e e e 9 e e e 4 4 9 e 0 e e 9 e e e e 4 S e e e A A e A e e Q e Q e- e e e A A 4 A A A A A A e Q A 9 A e A A e e 4 e e 4 Q 1- A A A A A e 9 A e A A A A e A 4 0 e A A 4 A 4 0 e e A A 4- e e A 4 9 0 1 e e A e 1 e 4 0 0 e Q A e A e 4 4 A 9 Q Q o e A A e 0 A A 9 A A e 4 4 2 ir Q e e e e a A 1-1- HOME FURNISHINGS OF THE BEST QUALITY FOR THE BEST VALUES K 0 H L 8: T U C K E R MASONIC TEMPLE 12351.95 SANDBERG BROS. n A A r r n no p : x p 1.na-1-rn.n-1-A-A-n-A-n no a r no A r A p A-A vo n A A n-wa-nw-1-A a no-n+r+ CONGRATUL TIO. S TO THE CLASS OF 1945 ' J. C. PENNEY CO. 228 SENECA ST. OIL VITY, PA. 1-+01-1-1-1-1 1 1 1 1 1 +1 1 1 1-1-1 1 1-11-1,401-4-1-11 1 1 1 1 1 of 1 1 1-11 1-1-1-1-1-1-1-1-1111-1 1 11-1-1-1-01-1-111-1 1 1 1-1 1 4 142 ,uni -no-x-ao m A A r no-1 w-A -r no-1-no-A-N 1 N-an A 4+-ra oo-aa-N-x-.wvooo-:oooran-so-so -no no-n-noe-no-r -n-n-:ooo-1-no A-n moo 1-A-nn -Q-N no-no-wn-we-x-1-zoo-A-N-no-o -no -ranow-Nov-no-a-p-1-n-n-pro -na rn-no o-no-no-n fn 'on n coo M-+ e au- e Q- e-een-so c- e--ru-+5 1 la o 3 5 e 9 v 0 a 9 Q s 4 e '? v va a ? Z 9 Q s e- 9 ? v a Q 9 v ? u .4 w 0 1. ooo:-e 4- + use oc- 4-1--4env:-x-oe-eeu-u-muwu'.- Y I. una, i Y v .9 4-Q Q 4-c-+4--fecvu-1-Q Q- o -ec-Q-c M.. eo:-N-Q oo .fe-e-ceo 1- von-e uw 44-ec-N-e oc- -oem Q 1- e new-e Compliments of ROUSEVILLE CANDY KITCHEN Meet Here After The Game v 1 ievm-x-rn-n-no-xo-1-no-M-M-r-N-ro-x-n-.mo-m-r-wma-:oo-aw-ro-1 ROSENBLiUM'S Clothes For The Graduate OIL CITY . MY CITY OII, CITY is the place where my home is founded, where my children are educated, where my husiness is located, Where my rote is cast, where my good neighbors dwell, and where my life is chiefly lived. I have chosen it after due consideration among all the cities of the earth. It is the 'home spot' for me. UII. CITY wants my citizenship, not par- tizanship, friendliness. not offishnessg co- operation, not dissentiong sympathy, not criticising difference. my intelligent interest, not in- OII. CITY provides me with law and order, trade, friends, education. morals, recreation, and the rights of a free-horn American. - I should l3EI.lliYE IN OIL CITY and work for it-and I XYILL. CHAMBER OF COMMERCE c 44- 4 0 4 -ec-1-Q -nooo-x-M-rxo-Neovo-1-:www-no xx u nm P 7 'Q' THE OIL CITY THEATRE CO. HERMAN L. STAHL, Manager THERE IS ALVJAYS A GOOD SHOW at the DRAKE AND LYRIC THEATERS Efficient Heating and Cooling Systems SODAS CANDY D E Y I T T 'S M C DAIRY AND SMOKE SHOPPE CARSON PLUMBING COMPANY J. P. McNally L. G. Carson 64-66 MAIN ST. PHONE 291 . ....,,......I.......b...,........,.. BRIDGE LUNCH STATE AND EAST FRONT STREETS THE IVRIENDLY PLACE TO EAT. QUALITY IS REMEMBERED LONG AFTER PRICE IS FORGOT'l'liNl SANDWICHES AND DINNERS, , c 0 c f c 1 4 c-4-ooo ff .v-io-no nm Q4-rn-:oo v-D o-9-no-9-9-9 0-xo wx 9-3-no-vw-roof-so-9-x-ao:-zoos rx- rr of -N-so-neva-no--moo xv 'rv :- -yo-: 4-so 4-rn we-w-2-x-L-n-no Q-soo no-1 -H -mor:-A-2 oo-x e- Q v-yr:-xofno-:vw-:wr x-no-roof -144940-rr oo-A-.va-o-.wo-v-rn o :sooo-1-M-1+-M 1- -nor-:wa Q runny: rnvf-x-1-nw rn n x an LAKE D. STEFF EE FUNERAL DIREGTOR xnnrnr nnnnn nn nn r x nnnnao .vnxnnr nnnrn 1 nnnrnu x n 1 a r , :nn XFN 'xx-X ff Q , I ll W ,O 1 l'!mNX 5 Bmmu X .p l X hi I I EER E!!! H! Euan., X rg 1: lg n- 3 3 E M' f ff du 'il l I 1 Gmaax me CONGRATULATIONS lo the GRADUATING CLAS9 f I945 MFNIBER 1' I' DFRAL DEPOSIT INSURANLI QORPORAI ION u-ccuuec-ucuuucooxcccuuuocx ucuuucuuucucec-noun-ucoocuuuc-cu-fc-ocuuu14441:-uofncaa-emu:-Q-Hou-:cuexc-mv-oucoucucecxuaccu 144 poo-N-no-no-xn-x-x-x-n-A-N-wnn:-xnnoonwxnnnonnrm+nnnnn-rnnnnnxnvnnnnnnoannnnn-Anxxvrnxnnnnnwm xnxnfnnrnnnonnfn A4-4'-4 oc- 4 4-4-4-4-4-4+ l 4- a fine DIAMG D is the gift of gifts 44- 4- -404-of-4-04-4-4-4-4-o 004-4.eo4-4-+414 oo4-oeo4-4-4-4-o4-4- There is no gift that can takethe place of a fine diamond. And 4-o4-4-4-4-e4wow-4-e4-4f4-o-oo4'oo4- there is proud satisfaction in giving a diamond of distinguished beauty and assured quality. 4-f4-4-4,4-ooo:-4-4-4-4-4-+4-o4,e4'o4-4-4-f We invite you to drop in and see our selection of fine diamond rings. Their superior brilliance and beauty speak eloquently for their quality. ec-4-4-o 4-of-4-4-csc-4-4-4-4-4-4-A4-e Diekinson's J elry Store The Jeweler Who Pleasesv 10 Seneca Street Dil City 4-o4-4-ec-4'4-4v4-4-4'4-4-4-4- 4- 4 4 44- :xnnrnnn unnnsnrn-nnnxrnnnuna-A-r-nn:uno-snr-rvuxrnrn nn-1-n-:nnnxnnr nm-no no-nun: '? v v -: 75 L. G. BALFOUR CO. Manufacturers of the Finest High A 44- A A A A A A A A A e A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A A 5 School and College jewelry. ' Manufacturers of the 1945 Class Rings and Pins 4 4 4 4 4 4 4 4 4 4 4 4 4 4-04-4 4 4 4 4 4-4 4 4 4 4-4-4-4+ 44-o44-4-4-4-444-4-4-4-4-4-4-4-4,4-4-4-444-4-4-4-4-4-4-4-4-4-4444-4 4 4 4-4-4-4444-4-444-4 4'4-4-4-4-4-4-4-444-4-444-4-4-4- 4 4 4 4 4 4 4 4 4 4 4 145 ., Y ora -Avro-neo-:oo-vo-:oo-0-rr-x-A-1.9-my-:ooo-A-wo oo-poo-A-no-1-no-M -no-9044 a oo-no no 4 o ws oovaoa-sooo o x-r-s-no-no-frA-nas-n-so-r-so-so-no-A-:ooo -ro r rr n 0 e A -1-N-n-x-,ws 9 tn A in-no-r-1-ro-n-af:-w-rn-m-m-m-no-no-M.N-no-no-f-Q-w-r-no-rn-, -v-no-n-n-m-x-r -n -n-no-1-m-9-m -M-n-x-m-n-no -r-x-x-x-x-M-n-m-1-rm-n-n-nfm-n-nlf-m-1-no-x-r-x-x-r -moo4-no-1-no-w-no-na-mop+molmg e A 9 nk 9 . . , . 9 A 3 3 V 6 Z 2 9 B 6 5 v A Z , 2 +9 5 9 4 3 . 3 3 1' 3 9 ' if - Q 1 1. 4 3 gud 4 e 2 9 4- - . . . A 0 7 ' 9 v THE STUDENTS STORE 9 6 v WISHES You ef 6 V 9 9 e v ' e a e ' o Z Q 9 0 e . . SUCCESS 6 . vb 5 '7 9 5' 9 9 0 5 9 9 ? 4 6 9 9 9 9 9 9 9 9 9 1' 5 Q 5 1' 9 Q V Q 9 5 9 9 9 9 9 -. 6 4 S4933 e iv e 9 S 3 Q 1f,..ff-5--,Syd , + 5 X40 -.-v' 24 . S ,-.-.-.-2-.--0 , Q , 9 9 9 9 9 9 W 9 H? Q 9 9 5 T Q 1' + ' 4- 9 5 9 6 5 Q +- 2 5 1 9 . 9 3 3 5 vb-N-1-ro-1-x-x-1Am-no-so-no-r-x-wwa-1-rr4-no-1-r-No-1-rr9-1-norn-1-no-xo-no-x-noV:-x-no-n-n-x-1-no-Q-rn-n-mlm-1.1-rQ4Am-x-n-x-x-rvm-m-MArn-so-x-n-n-n-n-no-w-mmm-no-x-1-1-r4An4-rxrx-n-no-a-mln-1-x 2 9 9 ' 6 Q, 2 Q 9 1 Y 'J A . . lf Q 2 . , . 9 0 2 Y 9 L .. , . + - + 2 . - , - Q COIUPIIIUCIITS of . M I Q H A E I P 0 I I S 2 5 Q ' ? 1- 2 Y 9 L Y 9 i Y 9 in V 6 ' Q- , 3 9 'f A 'f 9 fl -1 e 5 0 8' ' THE w1LLows Goodclothes e Q e Q . e e Q , . Q Q 4: . XYillow street on City, Pa. .xm.1Nc1'1'0N Ho'1'1cL BLDG. .,.,.S.,., .,.,.,,.,.,.,,.,.,.,,, ., .,.,.,,.,.,.,,.,.,.,.,.,.,,.,.,.,.,.,.,.,.,.f .,.,.,.,.,.,.,.,.,.,.,.,.,.,,.,.,.,.,,,.,.,.,.,.,. f-x-rn-no-n-m V: -1-x-x-N-m-n-so -r-x-Nix-rnlrmlr-1 w-mvw-vnu-x-x-r-rx-x-1-a-no-x-r-x-x-v-r-1-n-:om Compliments of R IE C K ' S A Y. M. c. A. CAFETERIA SEALTEST 'lm CLUB Houss MILK AND ICE CREAM Yincent Hays, Prop. W 5 S 3114-M-arec-4'Q-crc-4-1.4M-ocM-1-N-c-44-M-4-1-4-M-4-1-o M-u-c-1-c-u-c-1-c 4- c-1-c-4-c-c-1-c-N-1-+ u-c-4-u-c-4-c-u- Q-ui-c-u-c-1-c-1-e 1- 4-ou-e4-eM-1-u-4-ec-4-4-c-1-c-on. 4- c-1-c-4-u-oM-c-4-av1-u.M-ou-nof-a'ufu-u-uAu-c- 11-1-4-N-c-1 v -no -no-1 -N-Q-r-n-rn-y-w-w-n-no-x-n-no-r -no-1-N-N-m-r-N-y-ry-no-1-y-wo-m-1-n-n-no-Q 1-n-x-no-n-x-m-m-r-no-n-N-rx -a-x-N-N-rn-N-n-1-n-1-n-n-Q-na -r-,-rx-no-x-n-N -no-1-rm-N-no-n-no-y-N-n-rpg 4 e 4 e e . 6 4 , e e e e COMPLIMENTS OF Q e ef e 0 e o e 1' e e e 4 e e Q Gakwoocfl R055 ancqenlox 9 Q 9 1' 9 9 'P Q 9 'B Q 1' Q -.ll 1- 9 0 0 'f Q 'P B Q 0 9 4' 'S ' 9 Q 0I'lS S + 6 0 9 9 6 . ' 4- 4' 9 Q 9 5 0 9 . 1886 4- e Q e- Q 9 e E Q e e e 1... Q ,T 4- Q o 1 9 1- e e e e Q e e e e rn-N-, V,-rw-,-n-,.n.,.p-,-N-N-nw-r-1-n-,-w-x-w-rw-n-w-w Q w-Q-no-n-1 -,-w-1-M-:Q-w-n-a-w-n-1-no-3-,-r-w4-x-no-w-N-y-w-,-y-N-1-,-y-rn-,-, , -,-,-M-rn-R-n-1 4-,-,-y-N-M-pm-r-w-we-.v-n-1-r-w-1-N-H-H-N 3 A . 6 A e . CQMPLIMENTS 0 A ev 0 e e ,, o 5 e :- 6 '3 4- 'B CHARM BEA TY SHOP OF Roonl 413 CUMMINS' SERVICE STATIO e e- 1- 4 6 5' e 'f e 'f e 3 2 e 6 Cj 1 ty N Z1 t I ,H al B a H k R' ui I d I I --x-N-N-n-,-M-1-,-Q r-r-m-M-N-N-,M-vw-m-w-,-m-1-,-1-n-N-nq-rn-1-n-w0-NM-n-M-1-n-M-: 2 - 4' Elevator Scwice CO1111l111'1'1C11tS of RAYMOND CLEA ERS Expert Beauticizms 17110116 100 Q 6 . . A 9 4 2 ' A 2 O1 C' Y P 4 4, 1 lty, a. 2 2 4 2 2 . . e B 8 B 4 2 e A T 1-1-eeu-c-c-4-4-4+4-1-4-4-4-1-1-1-c-cma-4-c-u-4-c-u-c-1-4-+1-c-4-4-4-u-c-u-4-4 1-u-c-u-1-c-N-c-0 x-e-N-c-4-c-Q 1- N- 4-c-4-a 1-u-c-eu-ec-c-c-4-4-4-c-c-on-v1- u-N-u-c-u-1-cw c-4-e4-4-ooc-4-vo4-c-1-4-4-of-4-1-4-4-4-c 4-4-m-M-1-4-1-1+ 1- u-m-4-4+ 1-47 9 '? 4 i' fa 9 9 if Q ., o Q e 6 6 e zD0000O'i'D90 D'D'b99'Y90'?'l09-I0 P09000 P l00Q0000'7'lO'l90001l'l'lO0900 D D09 l2I9000O 300999000009 D010 I9 i0 799 P0 10 D DYCOQ Y. P P000 I0 D D900 P D90 ID ,QD 300+ DOQQQ P09099 949000009002 3 3 -2 0 5 '3 5 E E Z 3 I lVIAK E S CAR 5 Z f 2 5 . 2 3 - ll N Bette r 5 I I -' LA T L0 nge r Z . , 5 z 'I I I I E I , I 6 2 Q7 v -' 2 E L4 f I I 9 3 I 5 5 Q 5 QUAKER STATE OIL REFINING CORP. 5 , 2 5 OIL CITY, PENNSYLVANIA 4 3 2 5 3 ,.m.,..,,.,.,,,,,,,,.,,.,.mm,,,.4,.,,.,,,.,,,,,,,,,,,.,m,,,.,,,,,,,m.,,.,,,,,,, ,,,.,,,., + E 5 2 4 ' a I I Q IN V I'I'A'I'IONS . . for YOU . Y . I 9 0 FIRST- SECOND - -you are invited to visit our pop- -Ayou are invited to visit Harmony A 5 ular self-service Record Shop on the House -our popular model home I main floor and hear the latest rec- on the second floor. You'll enjoy ords-all the popular makes-Vid seeing the newest in fine furniture 2 I n 2 tor. Columbia, Decca, Blue Bird and and home furnishings. Come in A Standard. Come in anytime. anytime. 5 I P I 3 3 FINE V Russ FURNITURE . 11 A' ' DRAPERIES OIL ClTY'S GREAT FURNITURE STORE W . 9 Y ee- oo-rw? 1-om-un. .oc-Q -noe-n-N-1-no-wo oo-no -r-x-no-no-N-no +-N-N-rn-n-m -n-wa-moo-x-nw-Q-no-y-an-no-r-Q -,-ro-r-n-no-rmeo-m-z-1-n-n-noe-m-N-x-no-rm Q-w-n-1-n-n-m .p-na-n-n-no-m fm-x-x-x-n-n-rn -r-a-w-v-:aaa-rn m-un-moaooo-D rn O 3 '11 r' D-1 5 rn Z P-1 U2 O '11 - - 24 F' Q4 --1 C4 -u 2 mm z U3 -4: 5: 5- 5F av , . z E 9 9 4-M-Q4-++4-1-oo1-oc-a-1-c-1-ec-oc-oc-1-ov -n-rn-no-noo-nQ-n-rn-no-x-:anno-x-r-m 9 0 9 9 .5 'B O 2 -D-ri-D-D-7-D0 -D-D0-I-rr!-rl-I-D-Dlr!-70-ri-D-I-rr-D-D-D 'ht-7-D-200-D-D-D-D4-D-D-D-ri-I-D-D-7-W: -rlbb-7-D04-D-1-DW-D-D-D00?-7009004-D-to-7-3-D9-704704-D00-D-D-1-D0-D00-7440'V'rr-D-D-rl-1-A-9-D0-L-I-I9-D-D-D-D90-3-lb-D04-D-D-10040-1-D09-I 2 Q 2 2 E 4 6 4-4- -n-xo-o o-no 0 04 GI-0004-0 -91:1-C-06000 '0Q!'!'0l'1'l'6G04'0K'0C'00f'C a ' . 0 3 8 1' 0 2 9 - :- . 2 3 U 4 KJ 'r 3 1 Pi g PA U2 A ? rn 9 Q N P1 Il' gg 3 o 2 P. . M P - -' 3 A -' Z 'J z H U 3 E 9 ul 3 - IJ: 2 f I 5. O 4 f-r Q Q Q E 9-U UD 51 o fl- e UQ U2 2 . O 6 Q . . 9 . A Q 5' 3 - P-I 3 F1 . 5 U1 . + 8 . 4 6 Q E , 20090099'D-D'D0'D0999vD-D0-MD09-Dwiifhvbhd-b'b'D0'!'l0O'!','l0'l-D-D0 e 2 0 P11 2 5 3 A E H- - 2 -7 ' . . L-1 8 O 3 2 CU a ..- . C e A F, 2 5 - O 2 H 'D rw ' e ' ' L4 A e f ' 'S . fb 2 5 ..- w 5 Lf ' ' F O 9 2 3 c: 2 AO fs E rt CI 2 A '11 V g 5 2 Q F? g -1 e SU c 5 3 0 Q B FY' 2 C 5 -1 C L 'U + ... . y 2 ' 9 3 CC -4 . in r'P 2 V1 3 -4 , , E F 4 D'7'V'7'D09-D-D-D-P0-D4b'!0'7'!'D-D0 9090-D-D0-2000090-D0-D-D-D-D-I-D-D-DO-D040-'D'D'Y00'D9 4-4-e-of-4-oc-4-1-one-oo o one-Q -v-r-144+-m-rx-rn-x-nov-rm-1-1-r-M-r Heartiest Congratulations To The Class f '45 3 I e 4-on-ov uv:-:vom-1-+4-Q-4-ec fn-rr-1+-x-no-x-no-ro-r-:ov-x-Q 4-4-4-c-e -x-no-n-Q 3 S 9 Q 4-4- -N - e E 4 . . Y R , . c-My -rn 9 Ie Q e 9 e 1-4. .,., C OJ -IS -IS 4 e ? A ., , , A Y 5. , , 4.4.4, -rn 4 e .9 e y ef 1- c- -N 04.14, 4+ ., .1 .5 e- . a v . A Y A , , R. 4 4 -A e G 0 ? v 0 e 4 w 9 v ev a e a 9 v Y v Q a -E 4 e a 4 a 9 v v e 4 4 e 4 a a e a e 9 v Q -a 4 ? u 4 ef 0 a a 0 v 9 4 o ? v 9 v 4 E o 6 w 4- -? v 6 9 e a a 4 ! u a a i 2 v 4 a a A Q 4 Q 4 w 4 e e 9 9 -4 3 Q 4 4 o 4 4 4 4 4 G A 4 4 af -2 -2 Q i 4 s -1 a 9 1 v a 4 4 4 4 i - 4 a E' 4 Q 4 9 A Q Q 'F v e a 0 a a 'P 4 4 Y 4 a G 4 Q a 4 Q A 4 a 4 Q 4 Q A Q Y v -F v e a -7 o e 3 v Y v Y -4 i 1 4 4 5 'Q 4 A 4 4 4 E 4 Q e i Y -4 a 4 Q 4 e 4 4 4 4 4 Q no+-n-Q44-xon4-x-xov-m4-rx-n-no-r-wwQ-m-m-no -y 4-n-:4-x-1rx-rn-x-r+4-n-m4Q4-w-x-1a-r-x-rn-r9-rln-r-N-no-n-x-n-1-n-r -N-N-w-n-w -:-x-n-x-Q-n-n.1-n-1-1-a-no-y-QQ.,-N-N-N-n-1-N.v-no-y-m-1-i-N-no-N-m BEST WISHES FOR THE SENIOR CLASS OF 1945 CCNEY ISLAND LUNCH 279 SENECA STREET r-r-x-rn-r-n-N-1-.v -v-x-r-no-x4-r-r-x-xv-x-rw-x-rx-n-no-r-wo-x-x-r-no-x-r -s-ry4-xooo-raaov-1-1-1o-na-y-no0+-1-x-rx-x-x-x-1-N4--m-N-x-n-no-no -v-m-n-rn-n-m r-x-9-x-nw-1-N-x-L+-xooo-ra-1-no-r-r-rx-M-no-m-r-x-w -n-1 COMPLIMENTS OF Clare M. Marshall Inc. and Pennland Tanker-s Inc. ROUSEVILLE, PA. AL'S RADIATOR SHOP REPAIRTNG AND CLEANING Albert Redmond listilnates Cheerfully Given Phone 788, Plumer Road, Hassan Heights A . - 4 2 4 - 4 9 1 9 o 2 Q - o 9 a + 0 9 9 2 o - o 9 9 2 if 3 Z 4 E 9 4 9 9 4 a A 4 9 -7 9 -9 9 G 4 -a 9 9 9 9 9 -L 9 9 9 9 9 G 4 9 4 a 4 Q 4 -2 8 G 2 -2 , v 4 4 4- a Q G 3 .a . -3 ? 4 4 -2 4 -a 4- e 4 4 4- e 4- 4 4- + 4 o 4 s Q -3 4 e 4 o 4 ? ,. v 4. -a 4 9 , 4 4. -2 Q 4 4 a Q 4 4. o 4 '? 'S Y 4 Y 9 Z 4 ,, 9 3,-0M-,.M-M-rnv4-NQQ-n-soNov-nw-nowasNno.,-n.y.n-n-n-n-n- 4 i 4 Y 4 Y 4- 2 4 f 5 Z 2 1 A 1 A 'f 5 v 4 Z . , 4 3 A . 4 'f 'P Z 5 -a 4 a 4- 4. 0 vi 2 e 4- Z 4 + 2 a 3 3 4 Z 4 Q 9 G 4- o 4- a 4 o 2 ? . 4 4 4 4- 4 4 o 4- 4 4 4 4 6 4 o 4- a 0 '? Q V 4 -a 4 4 e o 9 '? 2 I 5 9 2 Z 4. a 4 -F 9 5' 3 I 9 ? 3 E 9 s 4 a 4. o Q -B 4 -? 4. v A 150 JOS. W. REINSEL Funeral Director 13 fyirove .NVQ-. Oil City, Pa. Phone 328 .,.r A 4 4 4 6 4 6 4 4 4- 4 4 6 4 4 9 4 6 4 4 4 4 9 4 A 4 4 4 4 4- A 4- 4 4 9 4 A 4 4 4 4 0 4- 9 4 4- 4 9 6 4 Q 4 4 6 4 4 4- 4- 4 4 3 4 4 4 4 9 4- 4 4 4 A 4 4 4 4 4 4 8 4 4 4 4- 4 2' 4 Q 4 4 4 4 4 4 4 4 4 6 4 4 4 4 4 4 4 4- 4- 4 5 4 4 4 4 4 4- 4 4 4 4 4 O 4 4 4 4 4 4- 4 4- 4- 4- 4- 4'- 4 4- 4 4 0 4 4 4 4- 4 4 6 Q 4 4 4 4- 4 4 4 4 4 4 9 4 4- 4 4 4- 4 4 4- 4 4- 4 6 4 4 4 4 4 4 4 4 4 9 0 9 4 4 4 4 4 4- 4 4 4 4- 4 6 4 4 4 4 4 4 4 4 4 4 4 Q 4 4 4 4 4 1' 4 4 4 4 4 6 4- 4- 4 '- .4.. e-4-4-1-4-4-4-oc-41nw:-4-44-4-4-as e -5 o Q 9' v '? v 0 ce 9 -2 1 fa ? v '? v Q '? Y 'f v Y v :- '? 7 Y v i v o '? u '? v ? Y v ? v '? Q ? v Q Y v e ? Y Y v 9 Q Q o o '? v Q 4 o 9 . '? v '? 'f Y v Y 2 v '? v 0 av o 9 v o 9 Y Y Y Y Y Y '! Y u 9 v ? Y v 9 -4 ? 9 'S E 9 6 9 E ? v -2 o o ? v a ? T Y v a Y 'f E Q Q v 0 ? 7 T v o o a 9 v e v 3 -mn-me-r-mv nomo-r-n-ww v 4-4-4-one-of-an-o oo-z-aofma-poo-rs Congratulations and 2 5 e 9 9 -1 2 ., . 9 on-4 1-4-o M- o-rose-nm w cm fa Vl- E fa U' rm Ca 2 'f 2. ., . ' Q v A , . v Fl' O in FI' CD :f '-3 14 o CID ,D E : is o '11 S E. CD E :J Fd' Q U01 Cn :v UD O :- O o lil . 2 , . '? 2 Z 6 - e I e 4-4-4-4-of-1-4' r-no-r -x . 2 + 2 E S 2 , . oc-+ N-4-1-4-4-1-e -4-44+ -4-4-ee-ec-c-oc oo-x-.soo-9-rn -1-no-rx-no-no-9-soo-wo o o M Frank J. Gill Official Oil Can Photographer 444- c-or-ec-N-+ of 4-xo-no-yo-x-:sooo-no-n-9-no-ro-r e 2 3 . 8 Y Q Y 8 Y 6 ' e 2 o , e pun -rr-1 -r -x -p ,- 2 6 ef e ef e A 0 0 e e e e 9 fa ec ef o ef 9 e e e 2 6 e e vs e A B e e o e 9 9 vs fs e e 1- 6 e e ef e e ef e e 4 e- e e 9 ff e e e e- e e- Q Q e 0 e a Q e a 9 Q e e ef Q 0 e ff e e e B 4- e ef 1- e Q e e e Q o 9 o e e Q e 6 ef 'Q e e 4 Q e e e- ef :- 0 e a a e Q 9 9 ef 1 e e 0 0 9 e- e Q o e e e 4 e 6 e el e Q 4 9 0 o e n -2 H EP. fb 2-H ow CD D: r-W U1 xl. G o Qin Pi Oi :Q 34 'U QPF 'D as cn QQ.. F ml-U in sb DG 151 - - -so-a-woo-mfr - - ooooooooooooooooooooooo-xoooooovmo r NATIO AL TRANSIT PUMP AND IVIACI-II E COIVIPA Y OIL CITY, PA. 8: NATIO AL TRANSIT COIVIPA Y INCORPORATED 1 88 1 TRANSPORTATION OF CRUDE PETROLEUM BY PIPELINE MORE THAN 60 YEARS SERVICE TO THE PENNSYLVANIA OIL INDUSTRY GENERAL OFFICE ........... 1 52 Q Q 9 Y 4 o ? Y Y v i 9 1 1 4 a 0 0 a 9 'E 4 '? 0 4 0 44. -4-o Y 4 -1 9 0 ? v o -4-4,44-4-414.4 4 9 e4-4- 4- 4-4-44-4-o 444044-+414-4-4-4. 4-444-ee 4-4- 404,44-4-4,4-4w4-4-avec +4-41 44' 41 4414- 4- -4-4.44. 14 4-4,444-4 4-4,4-4.4- 1-11-1'1-11-111'1o-1-1f1 1 1 1 11 1 1 1 111 1 1 1 1 11 1-1 1 1 1 111 11 -1 11-14141-1-1-1-1-1411-1-1-1-1-11111 141 111114141-1 11-1111 1111 1 -1 1 1-1-1 1 ao-1 1-1-11'1 11111114 1 1 1-1-1 11 1 11 1-1 1 1 11 11111-1-1-1-1-141-1-1 Read Compliments of THE NEWS HERALD HEw1TT'ssH0EsH0P The only imlepeucleiit paper in Oil City 4 1 1 1 1 1 1 1 1 1 1-1-1-1,1-1-1-1-1-1-1-1-141-1-141-1-1-1-1-1-111-1-141-1-1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 and Frzuiklin CALL OIL CITY 4360 6 Compliments of KRESGE'S in Yeuaugo County 5 and 4 4 4 4 4 4 4 44 4 4 4 4 4 4-4-4'4-4'4- 04-4-4-4-4-4-4-4.4-4-44.4-4-4-4-4-4-4414-4-+4-4-4-4-4-4 4 4 4 4 44 4 4 4 4 4-4 4 4-4 4 4 4 4 4 4 4 4 4 4 4-4 4 4 4 4 4 4 4 4 4-4-4-4-4-4-4,4-4-4-4-4-4-44-4444-4-4-4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 Get ou the list . . and know what goes ou 2 vAF 'l fi S-142 Keep Your Car Alive l1y Using lf Properly . . . You Will Help Sonserve Viral War Maierials . . . See Your Nearby Z Man 1 1 1 1 1 1 1 1 1-1-1-1-1-1-1-1-1-1-11-1-1,1-1-1-1-1-1-1.1.11-1-1.1-1-1-1-1-11-1.11-1-1-1-1-1-11-1-1-1 11 1 1 1 1 1 1 1 1 11 1 1-1 1 1 1-1-1-1- '11+1-1-1-1-1-1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Yes, Sears Have lt! OVER 100,000 ITEMS TO SELECT FROM AT SEARS CATALOG ORDER DESK Actual Samples of over 10,000 Fabrics to See and TOUCH TESTU SEARS, ROEBUCK and CO. 4,4 4-4-4 4 4 4 4 4 4-4-4-4-4.4-44.44-44444-4-4-444-4-4-4-4-4-4-4-4-4-4-4,4-4-444-4-4-4,4 4-4-4-4-4-4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4-44 4-4-4-4-4-4-4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4-4.44-4-4.4-4-4-4 4-4-44-4-4,4-4-4-4-4-4 c-4-414 4 4 4 4 4 4 4 4 4 4 4 153 71 41 ev e- o 1 e e E 6 e 4 e o Q o e o A A Q e 6 9 e a 4+ e 4 6 a 4 -1 e 4 4 4 0 4 e 4 0 A 2 E 0 3 1 5 5 2 9 e 0- ef e A A 4 ex e 4 C' e o A A e 9 e 9 Q e 1 9 Y v 0 Y v o Y Y v a 0 Y v 9 Y Y v Y Y Y Y Y Y Y Y v 6 9 Y Y Y v Y Y Y E Y Y Y Y Y 3 Y v 9 v Y Y Y Y v 9 Y Y Y Y Y Y v Y Y Y v Y v Y Y Y Y Y v v 9 Y v Y Y Y Y Y Y Y v 9 9 Y Y Y Y Y Y v Y Y v Y Y Y Y Y Y Y Y Y Y Y v Y Y v 0 Y Y Y Y Y Y v 9 0 Y Y Y Y Y 5 Y I Y Y 1 1 v Y Y 2' Y Y Y Y -: 1 1 Y Y 2' v Y 'f 1 v S' Y Y Y Y 1 V 6 Y -r Y v Y 2 Y Y -: Y Y Y Y 1 .. w v G Y V ? 2 Y Y . ? Y v in Y .. 9 -. 9 Y 1 5 V Y + G ? E 1 v ? v '? . Y . 9 if 4. -x-www -no-n -u-no-va -r-x-1-wma-no-x-y -no-m-n-n-n-m Q.w-n-no-rn-n-xAn-1-x-n-rx'n-noooQ-1Vx-x-no4-my-a-no-n-rx-1-no-A-A-1-x.rm-r-x-:-n-re-vm-nrrmao-ro +-n -n-a-my-png -,-Q-A9-no-1M-14-vm-x-x-no-a-r-2 Drink TRADE-MARK REG. U. S. PAT. OFF. , The Pause that Refreshesu Compliments of Bw Oil Cityls Leading Women's Store Complete Outfitters for Girl Graduates 0 109 SYC.-XMORE STREET 4-4-4-01-44Qc-N-44crou-oM-4-c-ec-eocc-c-4-4-meN-uw-u-c-1-4-41-M-1-44M-M-crc-4-4-oQN-onc-c-1-4-4-4-4-N-u-e no-nos +4vw-a-no-1-n-r-1-r-r90Vx-wrx-rx-x-rr-no-x-n-no-1-r -A-r-xlw-no-n-n-rn-no-rx-ra-rx-ry4-1A:o-up-r-x-rnAn-1-w-ra-rm-n-14-rr-x-ra-nv-no-n -no-n-n-n-M -i -w-rn-Q-m 4-rr -r-rxno-rn-no-y-A-n-x-no-M e A A e o e e o e A e E 6 e 0 e el A B e Q 0 e O e e e A e e e 9 4 9 e e e A e e 0 e 1 9 4 9 e 6 A e Q 9 A e e e O 4 3 e 9 A A 4' e e e 9 6 Q A e e A 9 0 Q e Q A e A Q A 6 A 9 4 A e- A 4 D A 'f e A e e e A e 4. 4. Compliments of L. D. BUTISTE Maker of Meifs Clothing Since l9l5 S. B. MORRIS AGENCY Your Insurance Friend Phone 309 ,MQW- 2 Nzttiouzil 'li1'ElllSlt liuilrling Oil City. Pa. Mm4.ui4.uc-mc-c1-1-4,4-c-c-oc-u-c-ec-c.4-c-1-4-4-u-c-4-4-nw4-om.1-4-1.u-u-4-oc-o4-u-1-4-1-u-o1-z'uAc-c-u-c-a-c- 154 ,. e e Q- e e e 0 e e 4 6 A L + e e 1' e e 4 Q 0 6 e e e Q e 9 Q e e e o 4 e e Q 6 e 6 e e e 9 2 4 ef e e e Q e e e 4 4 4 e e e e e 9 e e e 9 4 9 3 e e e e -e 4 A 4- 0 2 2 i 2 0 6 e Q e e- e 9 e e- e 9 0 2 4 e e e e e 0 e 4 4 Q 4' e e e e e 4 e 4 e 2 6 0 e e e e e o e Q 0 2 e A e e 9 e a Q e- 4 Q e Q 4 e e e e e ef e 1 4' 8 e A 6 9 e 1- e e 5 0 e e e ef fa Q e e A A 6 6 ef e A A e e 1 e A 'P 4- e e e e 4 e e e- e A e e 4' e e o 4 e 4, u f. 1-1- v v 1- v v v v v 9 v 0 v v v v v v v v v 9 v v v v v v v v v v v v v v u v v v v v v v -4 -v v v -. v v v Y Y Y Y 3 Y Y -1 v v v v v v Q v v v 9 v v v Y Y Y Y E 0 5 Z Y Y Y S ? 5 7 Y v v v v v v v v v v v -4 v v v v v v v v + v v v v v v v '? Y v 9 Y 7 Y Y v v v v v v u v Q v v v 9 1- 4- 4-o oo 1-1- 4-1 vc- no 1-1- : 2 E E 'f A Y A z 2 9' A 5 E ' 2 w I : 2 Q 2 2 3 2 I 2 9 A 5 CONGRATULATIONS AND BEST WISHES TO 2 9 A 3 THE CLASS OF 1945 E 2 E 3 Q j FROM g z E 0 e 3 S 9 0' 3 2 2 0 g - Knox ass ssoclates nc 2 9 ' ' 2 2 5 'I 2 2 E - GLASS C0 TAINERS - 3 2 2 . 3 . E 5 E 2 g O I L C I T Y , P A . 5 'S 2 3 2 ' A 2 E 5 E 2 -2 2 V A Y an Y n 3 2 E 2 3 2 6 5 no1unnnnn11up-w-n-no-N-1-xnnrrxrunnrnmxnnnnxnrnnnrn:rxnnn-za-so-z-1-rua-:nunrrnno-n-1-no-1-w-n:N-r-r-no-1-rnnxnnrnnm-no-1-rr Y X n 2 4 - - 2 2 Y -S H 2 A 2 2 1 G 8: B N S 1 : 4- - I I E : A g 3 5 2 , . v INSURANCE AND REAL ESTATE E . 2 5 E 5 . . JE W ELRY COMPANY 2 2 E 2 2 A . i . . 6 E 5 8 East Flrst Street O11 Clty, Pa. 5 E 2 2 -4 2 9 n Q 2 Telephones 365 and 366 2 1 E 3 5 2 2 : a Q v 2 2 3 g ., , , , . , ..,.,.,-.-,M-N.NM.,.,.,M.,-H.NQW,M.,M.,N.,.,-N-,.,.,.N.n.,.,.,-,.,.H , , , , , , , , g 5 E 5 2 ' KESSLER DRY CLEANERS ' v 2 2 3 3 2 1' 9 li 2 2 5 3 Phone 56 2 : 1 2 E Q VVe Call and Dehver 2 2 2 E 5 279 Seneca Street 14 VV. F1rst St. f 2 2 E 2 2 3 5 E I 5 CONGRATULATIONS 5 Y . , Q - E 255 Seneca St. O11 Clty, Pa. E 5 5 S S U N S E Rl 1 2 E ' 5 O , Ro us ev111e 2 , e A 155 -sooo-Q-vm-ra Best Wishes To The Class of ,45 SPALDING'S PHARMACY n-no-r x-1-n-no-moo-1 'moo-a5-No-rn-n-x-no-naoaooo-r-no-x-nan-x-rn-1-x 9 v w :- o o o 9 v o o o 9 v o o 4 o a 9 v + w S Q o E o E Z o o o e o o 2 X v ooooo-x-N FINIS oooooo-woo-boa VVhen the last line is read. and the last .. ,... .mm FE III FP -. Ui rf 99 Pr Q n-J Kc o : 1 T C .. v-3 o f' U .. Q. m -4 V. 533 1 FD P-H H. - Z. M - ., FD Q 40 long to be remembered and clierisbed. 2 COMPLIMENTS OF ' H E We wish to greet you one and all. Life E too, has its final test. when you are weighed in a balance. YYl1icl1 side of the balance 2 have you been on? JOB PRINTING 5 5 Our loved ones pass from us daily. XVe 420 XY, 41511 St, Phone 119643 undertake the final ministrations of your beloved in every detail with tender care. Cofillffllts CRAWFORD FUNERAL HOME 5 C. C. Crawford MAR GREETS DAIRY SHOPPE Prop. Mrs. M. Dunlap 56 Spring Street Q., F FU Q .15 E v-h O 1 fl- 4 9 4' e 4 e 41 e o e Q 9 A Q e Q ef ef 6 9 Q e e e 4 6 e e e e e 0 o o 9 9 + 4 e Q e e A e e fr 9 e 4 A 6 fa e e a e 4- e 4 e 4 0 9 o 9 e o o e e 4 M-no-p 4 e e e 9 9 9 9 e e e 6 0 Q 6 9 e- Q m Q 0' ef ef 4 e e o 4 e 6 e e e e e 9 0' o e e we 9 9 4 e- e e A 0 Q o 9 a 6 e o e e e 4 9 e ef e e ef 9 o o a 4 AGAIN WE HAVE THE PRIVILEGE OF FURNISHING THE GRADUATION ANNOUNCEMENTS MADE BY THE EDUCATIONAL SUPPLY CO. FOR THE CLASS OF 1945 H. P.. THOMPSON J EWELER ODD FELLOWS ARCADE When you think of Jewelery think of THOMPSONS lc-or-c-eu-41-N c-u-ec-c-oc-0at1-c-oc-of-4-4-4-are-oc-4-4-M-esacvc-4-N-4-c-1-1-c-cw4- pc-4-1-ou'-eu-1-cvc-c-u-1-c-:vc-M-4-04-u-M-c-c-u-u-c-4-c-4-Q-u-4-4-or-c-Qon-Q-4-u 156 -:oo-no - -2-noooooooo-:oooooo-A-ro-so-r - fxoovo-rm-x-no - - - M -, 6 9 6 9 ? V O + . 9 v v . 6 ? . 9 V i 6 ? 1 -: . 9 v -3 1 Y V 1 + V G ? v 1 . 9 v 6 v t v . 9 2 1 1 . 6 '1 2 V ! v 6 Z . 9 v 6 v v 4 + o Y .- e Q 9 v ! 1 o o ? Y v a E 2 Y Y . 9 Y Y Y Y . 9 V V G 2 Y . -2 . if 9 . 9 Y Y . 9 9 ? Y Y . 9 Y Y V V 6 + .. 9 Y . 0 9 . 9 v Y . 6 0 6 9 Y . 0 'P 9 Y v 9 9 9 . 9 . 9 Y Y 1 v . 9 0 + Y Y Y Y Y Y . 9 G 6 + Y . 9 G -i .. fr Y Y 9 9 Y . 6 6 9 ? Y i 9 9 Q Y 9 f Y . Q V G 9 0 9 Y . G 9 -r-no-Qrx-ro-sooo9Q-rno-:-no-1-rs-rr-2by-x-x-r9-944+-x-r-rm-1-2-r-1-19+-1oo-r-rx-was-an-n-no44-x-no-ww-s'r-x-rwQoo-rooooa'xln-no-xo-4--xQa-v-9-rrQ-nov-rn4-rx-xo-no-ev-no4o-2o-No-r-nv-x-m-r-9-rn 100+-was-x PRI TI of the better kind Planned and Produced THE DERRICK PUBLISHING COMPANY OIL CITY, - PENNSYLVANIA TELEPHONE ------ 4362 NX ooownos-ro aoao-ro o4-1+1-9ooo-row-woaooo-neon-ro fo- wwe-rx-new-sn ooo-so no-3 o 9 ooo -1-3 no I-vm-rn-N-x mm-www-rm-m rwrvavwoQa-moooo-no-z-no-x-xo-rn-noooo-N-nowr-w-1-:own-1-m-wwx99o-noo9-No-m-na-w-N-no-Q-A-1-1-nQ-Na-1+-nsoooonoooo9-so-ro-no-:oo-9-no-no-rr ? -1-c-N-u-c-o crc-crQ-N-1-1-u-c-4-c-o 4-u-u-4-cl1-c-M-cw1- u-u-u-c-c-u- crew-c-c-4-c-c'm-x-c-c-no0N-4-c-ovc-1-eu-4-u'c-QM-4-u-4-ou-c-u-ou-1 4 -4-c-4-u-1-4-4-4-4-+ c-from-M44-c-e 4' - -can-urc-eu-o 4 u-4-4-u-4-c-44 1- 1- 1 c-n-u-:-u-- 157 aqutocgpmcqp HA aqutoqncqp ha