Mdliliille .-X lJI'HilllL'llllIl of the IDL-p:11't111e11t of .lmn'nalism of lim-vli School. , - . . lln- stuclcut memln-rs ul tlus clvpzmlm-ilt alan lD1lllllSll the I?r4'd.' lfzrglv, Zlll AXllf,-X1mA1'iCz111 stuclc-nl m-xvspznpclt Thu 10511 ,lflhflllllff has Zllftlllllltil tu show :1 Q1'ussfscct1o11 01 lircck School z1ct1x'111cs m tlns stuclcm-symmmsrwccl zumuzll. L. R. Milburn, Faculty Supervisor 7?50 Your T950 Mustang staff worked hard on this book. My sincere thanks to Tom Bodin. His writing for this book is, as always, excellent. Thanks to Dick Aslakson. The selling of ads for this book was a tremendous iob. Chuck Hartley as promo- tions editor supplied additional money to supplement that obtained by Dick. His iob of selling candy after lunch, only one of many iobs, was a very dreary proposition. He also did some fine writing. As always, thanks to Mr. Weston and the men working for him. l wish I could tell you of all the valuable aid they have given us. Mr. Percy and Mr. Kirley of Lumberman Publishing Co. were also very kind to us. A. 1. Dahl and Sons Larry Lindsay, Editor were responsible for the fine cover of this book. Thank you, Halmrast Studios, for the pictures in this book. The photograph- ers in student body headed by Nippert Smith contributed many good pictures. Thanks to Sumner Young. Sumner was a gen- eral handy man and trouble shooter. The rest of the staff also worked hard and long. What I owe to Mr. Milburn cannot be put into so short a space. His help as a technical advisor was, of course, great, but his greatest and most lasting aid was that of a friend and a counselor. Larry Lindsay, Editor. puificaliand glad STAFF WRITERS , First row, left to right: Dart, McKelvey, Larcombe, Beaubaire Byerly, Creevy, second row: Iunkin, Sohlberg, P. Thatcher, I Thatcher, Frisch, Imm, Ferster. ADVERTISING Herbert, Aslakson, Frisch. TYPISTS Roosen, P. Smith Lower left: Photographers N. Smith, Lilly, Oppen, Sands, Greenberg Below: Librarian McNary. Charles Hartley Dick Aslokson Promotions Editor Advertising Editor Fawdmtdaaa Zaldtaw M, 4 NMA. --... ' - E l . Sumner Young Tom Bodin Executive Editor Bugle Editor .I . Headmaster ot Breck School Only two short years ago, Mr. Morison Brigham assumed He has worked tirelessly toward the perfection of all phases the position of headmaster of Breck as successor to Mr. Chester of school life here at Breck, and through his hard work he has H. Deskochers. In these two short years Mr. Brigham has done new interests for the boys. He deserves the praise and thanks a tremendous iob of developing Breck School into one of the out- of everyone connected with the school for all his hard work to- standing schools of its kind in the country. ward the promotion of Breck. A 5a greed! ciaaf cz The faculty of Breck School is devoted to the task of giving every boy a sound back- ground in the fundamentals of a strong secondary education program. To do this iob correctly, it takes the undivided and unselfish attention of each teacher to his work. All Breck students feel this spirited work within the faculty and know that faculty members are genuinely interested in their welfare. They are constantly striving to blend a program of development which will be valu- able to each individual. Mrs. Evelyn Arenz Hind Grade Mr. Earl Breault illirfrllv 561111111 Hixtoffy, Hockey C'0uc'11 Mrs. Beatrice Brown .S i.1'tlz Grade Mrs. Marie Brown Fomftlz Grade Mrs. Ruth Carlson SL'Cl'L'ftII'itI1 Staff Mrs. Anne Delger lfilmlriaar Mrs. Marylyn Dineen .S'0c'011c1' Gm-do Mrs. Geraldine Doheny lef'IIIt'lHtI1 lx'n1f1'i11g Mrs. Leonore Dunn lfvurflz Gradv Mr. Raymond Genovese High School Hixfory, Trafk C'0f1f11 Mrs. Olga Hallberg 51.1111 Cnadc Mrs. Maxrne Halvorsen Art Mr. Howard Hathaway l,lI,VA'1l'.N', TC1llIl'.Y CUKIFIZ Miss Lorena Hinrichs St'C7'l'11II'1fI1 Sfflff Mr. Joseph Jocketty High 5011001 PII-A'f!I1 X', lfaskvflnrll COLIC1I Mr. W. A. Jonnard 1111111110 50111101 lirrglfslz Mr. Charles Krenz lligffz .S'fl1oml lfalgflislz, ff4.'I'llIfIII, lfrvrzclr Mr. Kenneth Kvien lliglr fallow! .-llgcbra, C11It'1IIl.X'lL7jl Mrs Norma Kvren l'.r'.vf ffmrrfv wnv and 511. go, go D, Ulf. up 1 abd Guam Miss Doroihy Larson .S4L'l'1'L'flIl'j' of ffm' llvczrlrzzrrstvz' Mr. Dale Morrill . lffllfffc 17f1'r'r'lu1' Mr. John Nelson High Salma! .'llr1tl1c111aIic.v Mr. Charles Olson lvmlogs, lm0f111z3, Bazscbzllll Coach Mr. Harland Olson Alllddlv Sflzool AlI1IfllCl1ltIfll'A' Mr. Ted Osman lligflz .Sffzfml Erzglisll- Mr. Lloyd Plette glf11.r1'r' lJl7't'f'Il0l' Mrs. Gyda Plette lfiflfz Grade Mrs. Hazel Ramsey l Fifth Grazia? .5- Miss Elizabeth Sodley Rv111m'ff11 :lflLlfflCIllllflL'.l' Mrs. Burburu Schiliz Tlzfrd Cfrmlc The Rev. John Schmolstie - Ummm g Miss Helen Seefeldt Mr- Mmhuel Umm SU.,,L.m,,iU! Smff lligfz .SlC!li1f7!.l,1!Ifl1I, Sfun fmlj C 011071 Mrs. Helen VanDeWuter l70r111ifnry lln11.w11mll14'1' Mr. Philippe Verbrugghen lx'ir1'i11g l?i1'm'tm' HARRY H. SMITH Mr. Harry H. Smith, high school dean, withstood the trials and tribulations of the prin- cipal's office quite successfully during his first year in that post. His door was always open to cadets seeking to improve scholastically, and he treated each and every problem with an experienced hand. He has patiently listened to excuses for lateness, absence, etc., and he was an invaluable aid to the seniors in their preparations for college. As though his schedule were not full enough, Smitty also served as advisor to the Cadet Council and the Honor Legion. J- ......- W When we were in the grade school we used to look at the High School Building in awe and wonder what went on inside. Now that we are up in the high school we perhaps lose a little of that awe, but stop to think what goes on inside that building. The foundation for your life is laid there. You receive an im- portant part of your education for your future life there. Not an education in iust the readin', 'ritin', and 'rithmetic sense of the word, but in life itself. When you enter that building you are a young and silly freshman. When you leave it you are perhaps still a very young and foolish senior, to be sure, but the im- portant beginnings of a man are with you. , 31: X EH 4 -,,,,75 5 x M. 4? Ut '- W .az In 'kgs Q M r' -1' Kp Lush K M . M A f ix 2 if 'A' A nfl 1 1 4 1 ' , -. .,,.: : , 1 ki il W . 9392 ... J A 1 I 4 I Ei KE 1 v-W5 av . f m- .,.. .. Q W 1? if 3 if 5' :ii 5 3 ' 4-, 1 1 A ,.. 3 15 3 P wp ff mg . 5 ,- Q, '5:,, , s .,., :E t : Vg L: 3 mx ef f Z' Q 93, f Q M R' . W H Q A 5 m -K A H A Al -.-ji? F Ja S 1 .F ..., H 2 W, ,Q LQ , 1, , .. ' Q I- Et . 'S' 2 2 -A nlls E :Q g Q ,. EI' I :ig A ---- ' ---Q- M ,W --'- 1 ' f-' ib' ' w Q, 3 'M ei ' ,... ,:,,' A , .. I I: V , ' 42- .,,, i :lf V? , f ' , an - ,- ,1 I 23? 5' ' .23 5 0 X MQ W? 5 E' ' Wm + B 5 1, - Q ,. - ,I - 2 u 3 . gr ,.1 . ' ' ':' I? ' 1 L U ' ' was S fy O , ..,,, ,.,,, , ,. vmwwwnmmfgw- I, 1 r 2 f lm w , yy F Q- 1 ap- ? 4 A 1 ,J :,. W? Q in I , , 3 77 ,, . x gg i ' vg, A Q j q ' 3 -31. '. , -. 23 . ff , i .. f -s W N wg T wx f Q W . . Am., V- N vff- M ,..,,.. - r vQ PM wi ewes sezmz mm CASPER HEASER Mr. Casper Heaser is generally considered by the students as the hardest working, friendliest faculty man at Breck. Mr. Heaser has one of the most difficult jobs at school. that of the principal of the primary and middle school. He must deal with many difficult situations that require a profound knowledge of boys. Mr. Heaser sets up the entire activity program in the grades, he supervises the military work and heads the academic program. Cap, as he is called by those close to him, is a dependable counselor to the boys. He is a sincere man who is striving for an even better Breck. Ride 'em Cowboy. in line Qaacle Salma! Let's See. Port X and part Y fit like so. Future iet pilots. af of gmc! When you enter Breck School you go first to Haupt Hall to enroll. As a little fella in the grade school you look forward to the day you will have classes there, and when in the High School you think of the days when you had classes there. And when you graduate from school you go there once more to receive your diploma. Try to imagine Breck without Haupt Hall. It's like cake without frosting. Both make things a little tastier. EIGHTH GRADE lfront row: Clizlrlt-5 liuhintielcl. -lohn klnnlqin, .lohn l'ctt-rson, lk-tt-r Blaflclt-11, llerht-rt Micliclvt-y. .Iessc Swansoii, Minor Gold, XYilliz1ni Kozlznlcg st-concl row: Donalcl lflziwlcinson, XVilli:1n1 l,l1lflSlI'UIll, Robert llncnsin, Dzivicl Strzitc, Frank llcpirre, Cliarlcs lgClZ1llgC1', Robert 'llllZllL'llUT, Rohcrt llC1lClCl'gE1Sl, :incl .Mex Syro- lioyarskyg third row: Colyer Xlventwortli, 'lhoinzis Hziint-s. liclwzxrcl Koch, Dino ,Xnclerson, Craig Smith, Hurlun Strong. Louis iXllnrvclit, ancl Klichzit-l Tuck: fourth row: llzuil Jolinson, ,Xlhvrt Schultz. Daniel Coht-n, Max Scliottlcr, john lackson, Donald VV. johnson, lilonalcl lf. johnson. :incl Otto Hruiilit-. SEVENTH GRADE ...IAc. . First row, left to right: XYilliani Clzissncr, Philip Mt'Nz1iry, Irving Anderson, Nur Harris l.t-vine, Dennis Hyinanson, XYillizun Schot-ning, ,lanics Moore, Miclizic Gott: thirrl row: liiclizinl Ettner, -lohn Nelson, jzunt-s Slack, 'Izuncs Bell, Murray Gzilinson, Ilouglzis liwzilcl. Cliarles l,zizt-rine. vin lilooin, Ilarolcl XX'cilzmtl. Rayinoncl Smith: second row: Uzxvicl llichaelson, l SXTH GRADE .1'1'11111 1'11w: 1J1lYlf1 1.ll1l1'S. i1:11'1' 1qt'b1111II'. 130111115 111-1'g111z111, 11111011 1xc21s11'1'. 1.ZlI'l'j' XY1'11z1'1. 211111 1111111 5112111511113 5110111111 1'1111': X1111 11l1Ill1, 1411111-1'1 SC111l1!l1111, 1,e1K'1 11115111-1'11, C111111 K1211117z11'1:1111-. 1011161 1311113 211111 1111111 '111'111'111'y1 1111111 1'11x1': 1111111 MCB111111-11, 101111 51115. 1111111 S1l'CL'1it'1'. 11I'l1L'l' 1111t1'11111s1111, .'X11lL'l'1 1i11s1'1'1. 211111 Stew 1fr111'11g 1111111111 1'11w: 1111111 N11l'11111'. 1111111-1'1 G111-s, 11111 Cz1s1-y, 1111111 gX1'1-11z, 1111111 1f11111, 111111111215 1Q11s1-, C'1'211g S1'121111'e, 211111 1L'l'l'1' 5111111511113 111111 1'11w: 1111111111115 Stev- 0115. 11l'11I'gl' 51'11'111111. 11111111111 S112l111lk'1i. 1111111 X1211'17:11'1211111. 11k'1L'lA H2111111'1s, 13111121111 1,1111-1's1111, 1Q1C1121l'11 Q'21111w1-11, 111111 1Jz11'111 11111113011 S1x111 11121111-1's 11111 111 1111'1111'c: N1-12 s1111 1Y111'2l11. B1ll1Al'1l1' 1j11111f111111. 1':1'1R' S:111111-1111. 1171111 1'11w: K11c1121c1 K1I11CS1,11l. 7111111111215 1f11'111, 11111111 1Jl'1J1l'1.1AlA, 121121111 1Q11111'1'1w. 1111121111 1111111511111 sc1'111111 1'11w: Cl1l'11S 11l1llC1L'11. 1':l'XX'1I1 1i11jes14y, .X111K'1.1 ,111111111115. -nffrey 171-1'st1-1', nX11s1111 A1ZlL'1'i2lI'12lIlL', N11L'1111l'1 C11-1'1'yg 1111111 111111: 1J2lY111 S11'2111fs. 111-111'g1- 1.Zl1lg, XY11111lIll .Xll1i1Zl1ll, 11lk'1i 11l11I1S11ll, 1Q11'11z11'11 C211111, 1111111 C11x. 11411111111 1J11'111s1111g 11111111111 1'111v: 5161111111 L'111l111l5fJ11,.111111l15 111111115 1f1'11' Nyc. 111a1'1111 111'11w11. 1'11'11z11'11 S111111111, 11211'y 5111111111-1111-1113 111111 1'11w: 15111111-1'11' 111111-N, -1111111 111'111-11Q51J11. 1111111 A1llI'l7111', 1,11 pX11111'1's1111, 1'tl'L'f1L'l'1C 1f1111'1'1112111. ,11111l1111lS .X111i1l1S, 11111 311111112 FWTH GRADE 1 Z Vlr. Verbrugghen drives the royal carriage. . . but how do you do it? So In te 'Wee Pa Breck Boys get their start in school in the primary building, and it's u good start. A well-equipped modern building, it contains everything that a boy from six to nine requires. ln fact, it could probably keep people of all ages enter- tained for quite some time. It features a small scale gym complete with bas- ketball hoops only six feet off the floor so that future Mustang bucketballers can develop sharp shooting eyes. No wonder those kids seem to have so much fun when they're down there. FOURU4 GRADE First row, left to right: l,eonzn'd Lang, Rohert liielienapp, Dennis Pearson, lid- ward Hutchinson, fzunes Xlztselc, Phillip Nelson: second row: Clayton Peterson. .lerry Manning. lYillizun Robinson. Christopher lirohaugh, Dennis Carson, Louis llztugherty, .lohn Anderson: third row: Lanny Beehilq, Billy Simon, Douglas Lind, David Henry, Rohert Nielsen, NVz1lter 'lliedeinztng fourth row: Harold Freeman, Rand Patton, Melvin litsley. Alan YVlIl1J6l'11l2illll, Roger Buhrt, Fletcher Tyler, NYilli:nn Xllestphal. Front row: Joey Nelson, liohhy Kelsey, Vllynn luran. Ronald NVQ-nzelg second row: nlehfry Hultgren. Robert Gaston, Cushman Minar, rllll011lZiS XXI-stlwee, and lYillizun Graftunder: third row: Gary Clark, Qlames Luyten, .Xelyn l,iehthztrdt. Kenneth Lippert, llenjzunin Smith, and Szun Bztlking fourth row: Michael Nye. Andrew Fedders, l.ee Krumpelinztnn, Norinztn Cztsperson, l,ee Barrington, George Conrad, and Robert l:l1lSO1ll. THRD GRADE SECOND GRADE lfirat ww, ln-ft to right: Pc-tvr -IUHSCI1, RiCl12ll'd Uolclller. Ilmlglzls Nelson, Clark -IUIIIISOII. Se-cmxcl rmv: Rolla-rl H1 mclt Hmul R ulchffc, l,m'zmcl Amlznllzlzv. hzu'1'v Alcifllllllnl, Timotlmy F11-c111:111, 'Vhirrl ww: Stun-11 BTOIIZIIIQII, Dzwicl Si6IJk'l'IIS. Ralph Hutcl1i11so11, .-Xustiu JXIIKICYSUII, XX'zLll:1Ce L'zu'Ism1, l'xl'Zlllklill lioutll. Fourlh 1-mv: jim Schzmuer. XYilliam llictrich, Ruln-rt Sukcr, Iiclwzml Hzllpaus, 'lxillll liric- sun, Rohm-rt HQKQIVQ-y. FIRST GRADE lfwml ww: Niclmlas Hl'2lllCfl, lcroirl Stillmzmg scmml ww: IIZIITV 142l'I'lJk'l', Rex X dll .Xlstimg 111115011 SI1lilll.2lllil Riclxzllxl Iluflyi lllirml rmv: Uurclml Mixfm. -lillllk ugh-, ,lL'H'1'1'j' l.ezu'itt. :md Michzu-I Sl1orm'. Seniaa Spook AI Junkin strikes again You like that huh, Roosen? Lower left: A tent would fit Holmberg More Yuk! Yuk! Don't hit Mike, Duni'l Yuk! Yuk! Sweet Adeline Firehouse five plus two Above: Receiving the crown Right: Next the ermine robe SS!ff3' 1l5i 4 f Ffg k fr gfgivwkix was ww, M 21 ff M ,gg .M yg v,,,w:Qg 2:5559 sz A gi-:gf Q wh Q ,D .ff X, , 5 ' Q F ,, ,-.vw WW my b q. fgg, me Q.. -V. '5'.?,f'w 1 'ff 32599 Jfamecaminq me, The upper left: finds Queen Cynthia cheering the team on. Upper right: finds more cheering support in Young, Williamson, and Bleecker. The middle picture is of the cur parade. The lower left: is iust plain foolishness. Queen Cynthia and escort Bill Johnson, dancing above received the tag from Johnny Junkin, an eighth grader oh, amy. 7fne Homecoming Ja, iniftfzed Zlfze lay i i 2 G ww Y? G fubiifmad You fiend! Why don'T you sing, John? Your lipstick is on crooked Bleecker fbainqet Oh Woodward! You don'1 meun it. Mr. Krenz's pluy A group of the boys were whooping it up. '7!ne Mdiiaaq The Grand March Here s to you Lets Dance M1 , Come on Denny Dwyer, Holmherg, Gibson and giris Gymnasium night club uniaa Wadi q Qaeda!! First row. left to right: -lunkin, Ferstcr, Eyre, Bruukc, row: C0-coach C. Olson, Robb, Mgr.. Beach, Kirkwood Golclhirsch, t'e11clcrg'z1st. liozlakg second row: XVolfso11, Norazrs, hfacksmt, D. Irxlmson, VVegner, VL-rbrugghcn, Co- t C. Smith. Dwyer, Scholllcr, Heger, IQLIIHIIFICICIQ third Couch R. Gcuovcse. The future football teams of Breck come from the iunior varsity. The ground work is laid here. ,-1 4519531 'wy- ,pfpw Y f dw, M - , W A M , 0 -4 ,:?,1..is QM., ., A 1 A .f , .1 .1 . , S 1 , v. . ' i f K fav E News E was 1 K P - P , , .. A- W ,psig-xg gms, ,B r. if -e - is s. 4 J M 0 qs N A QM Y X1,aimff.ai ' F1131 ww, left tu right: 0121011 l., R. llill1111'11. XY. -ltlllllf sou, R. Hmrllwrg, XY. llulluerg, AX. hllllllilll. Rowell, il. l31'ow11, llllllll. .'Xl1er11, .-X:4l:1kso11, .Xsst. Cllildl 'loc bloclcet- ty: sc'co11fl www: lf. llriscivll. D, Nc-lsmi, kil'L'ClllJL'I'g'. U11- tcr, lill':4t1'z111cl, lJz11'1. CZll'Ik'l', Szmcls. l',lL11lllllCl', Cl'2lNX'llJI'Cl. Wm' The Mustangs started their season sporting a smooth T for- mation and a squad of green kids. They opened their schedule by dropping their three following opponents: Princeton T3-6, Norwood 28-20, Concordia 38-19. They tasted bitter defeat on homecoming day when they were nosed out by Pillsbury, T4-7. Edina capitalized on Mustang iniuries and won by a 22-T9 score. Frazee, from the Heart-0'-lakes League, gave the Ponies a thrill- 1, I ,meg 5 es, A . 11. ,api xg 4 ,Y .,. ' .ss M ifsigp as in, y W f llzirtlcy: tl1ircl row: team 111:111z1ge1' KlcNz11'y. llwycr. Kliiw, hhvZlI'lTlCC, li. 1fI'llXYll, lilly, 'lf D1'isc'1mll, Sc1l1llmcA1'g, Hr1l111- mc-rg. tL'1llll lllZlIlZlgL'l' l.2llTl3lTCZl1'I l-Olll'llT naw: M1-clt-l111:111. bl. M1111-11 lQ1cl11e1',t,1. Xc-lson, l'. Q2ll'lStJll. ing game which ended in a 20-20 Dads' Day deadlock. St. Paul Park fell to the Mustangs' attack, 20-6. The Mustangs were the underdogs when they met a powerful Minnehaha Academy team in the season's finale, but the team came on to the field hotter than fire crackers and they didn't stop exploding until they had given the Indians a full afternoon of football and handed them a T2-0 trouncing. We Wan, We ZUCMI The photo at the right shows plainly how a little man was able to overcome a much bigger one in a football classic that will be remembered at Breck for many years to come. Bob Cotter lnumber 32l is shown throwing the key block that enabled Bob Holberg to score. fum! f'm Maude WW' 2? WW wk' .fs J? 'av .3 -wwf Bill Plummer Bill Plummer took his first crack at varsity football this year, and succeeded in grabbing a first string tackle posi- tion. It was a big step, but Bill filled the shoes perfectly. His quick charge won him the respect of his opponents in every game in which he participated. Bill played his best game against Fra- zee, a powerful single wing team. Sin- glehandedly he stopped numerous plays and helped ruin their passing attack with his great line play. Bob Cotior 955559 Every team has to have its 'Jack of all trades, and the Mustangs were no exception. Bob Cottor filled the bill for the Breck Squad. Bob was familiar with every position on the lineg however it was at the end position that he saw most of his action with the Ponies. On defense Bob always moved to a half- back spot so that his quick thinking and speed could be used to the best advan- tage. Bob Crawford was never a flashy linelmang he 11ever made any sensation- al tackles, and no one ever saw him make a crucial block that set a halfback scampering off for a touchdown. But Luke will be remembered because he was there when you needed him most! Bob was as solid as the Rock of Gi- bralter at his defensive guard post. The Edd reliable will be sorely missed next al . Bob Crawford Zim. .. . - Del Carter Operating from the left end position Del Carter proved to be Breck's ace in the hole. He was always at his best when it looked like the Mustangs were going down for the third time. It was in the St. Paul Park game that Del put on his best performance. The Mustangs were badly in need of a touchdown when Carter received a pass from his quarterback and ran over the safety man on his journey to the goal. Minnehaha lined up to punt at mid- field, and as the ball was snapped big Dick Holmberg came through the line like a stray can11on ball and blocked the punt. Breck recovered and scored on the next play. Breck went on to win that crucial game. The big tackle was strictly a defensive player and many a good lineman found himself willing to give up the ball rather than endure an- other of Dick's merciless charges. Dick Holmberg any Bill Holberg lfullback Billy Holberg showed the world that he was every inch a foot- ball player and a fighter as he boomed his one hundred thirty pounds into the all - conference spotlight. Overcoming tremendous physical handicaps he grabbed the Mustang fullback job and ran, tackled, and blocked his way to the top of the football ladder. His incom- parable ambition and spirit will never be forgotten at Breck. Jim Lilly 59559-y Although his favorite sport is hockey, jim Lilly decided to give varsity foot- ball a try, and did a very good job at it. jim did not make the starting eleveng however he played a relief role at end. His spirit was such that he never missed a practice, and never let an opportunity to improve his football slide by. jim played a great deal of football in an ad- mirable manner against Concordia and St. Paul Park. After three long years of plugging away, Dave Elfstrand hit the big time. 'fMoosel' became an indispensible cog in the Mustangs' defensive setup at either tackle or guard. He combined his big muscles with a fast, rocking charge that gave him the respect of his unlucky op- ponents. The big kid from Lindstrom, Minnesota, played the game the way a defensive lineman should: He played it rough. Dave Elfstrand Bill Johnson hhillCl1 tl1e word linebacker is 111e11- tirinecl one thinks of 21 hig, DOXVC'l'fllllD?1ll- player. Ylilllll is why people s111ile when tl1ey hear that little llill jolnisfin was a linebacker for tl1e Klustangs: that is, everyone smiles b11t those who have felt one of his crushing tackles. llill hafl an uiicannv way ahont l'lll11 which Cll- 2'lJlL'Cl llllll to tigure ont plays faster than 1111 enemy 1i11:1rterl1ack coulcl think of lllL'll1. livery team has its hancly nian, and tl1e Mustangs were no exception for they hacl Roger t,iree11be1'g. llis will- ingness to cooperate ancl in1prr1ve tnrnefl l1i111 into 11 hrst rate llL'I'f0I'lllCl'. Roger fillefl tl1e hill as 11 gnarrl, tackle, nr li11e- hacker. 1-X haclly brniserl hand niarle llilll lay tiff for two QHIIIOSI lmwever Rocky Rug was hack i11 time to aid the l'onics in the crucial Xlinneliaha tilt. Roger Greenberg iii? ' .M - 1 ' tg ' S 3 .' . Hg 1 H wig: :ire W ' f get .1 - M, it .. -2 w 1, 'W' Aifgkggyg 'Y ' iv we . , 11 ,, 111 1, 1 ,.,.. xg I if ,.,, ,N 9 N1 ,Ns , xi 1 1 ' mg l'.- f1 W ? '1 ' if ,. -' f 1, 1, f 1 Xjzwlggf, iafstff WV 2, .F H F A A 1 11 1 at 1 1 if 2551 .'11.fwV 'Y 'L' av '1 A at15?'Ram.i s, ti 1 fnllhac Chuck Dart I Chuck llart startecl tl1e season 111 tl1e li slut, XN'llCl'k' his running ability ecl hizn l'tllt'lltltJXX'llS ancl gl 1317711118 Q ory. ll1s fllllllls llllll him hun sli '-1 3 :L 1 '- -A 5 atterefl when the c11ll went ont tor a tackle anrl Illll himself with tl1e juli, hnt Chuck never said Z1 wnircll he just playecl lik' tot tl1e game with 21 tire, kincllecl with team loyalty anrl courage! Cllllt'lilr spirn helped l1r.ng the hlllSl2lllQ'S then' sne- 0055. Qaaldall 1-geniaad John Miller K1 s 1 '- smneiliing hu lzverv tt 1m 11111 t hut hinrl them in the way ef gfiml reserves. llreek cliflnt have many, hut they chrl mul one lll ltihn Miller. ltthn t til lam 11 g g V played either guarcl wr tackle: mils 1 spa t 1 1 cletni xt hnc his sea S011 NVZS1' 'll 152 ' ' ISI ' ' man. The highlight of l1is season e1Jn11 at St. l1'il1l l 1rk when l1e Chllllt' k'll'll '1ll 5 1 1 1 1 N tl1ru11f1l1 tl1e llllL' tn hltick the 11pp1i11e11ts try ter an extra ptnnt. 5 .X tl1c111s1111cl gripes ancl 11 tlifirisanrl teet of tape were all that tl1e t'H-lN3l1El- gers of tl1e XIUSUIIIQ' footlmall squafl heard or saw through tl1e entire season ick hlCN3l'j' anfl George l.an- phear clifl their jcwh with nothing' hut smiles. anrl wcmls of C11C0lIl'2lQL'lllQlli yet D pn iceef ell-icien anfl lhev aecepteml tlll'll' tliankless task lecl tri clo their wurk rinietly' anfl tly: thus cloing nifire than-their share ot wwrk as menihers tit the IU-ll! t1mtl111ll teani. Lunpheor and McNury ff! ' ' ..q.1- ,,11.311 1 1 E. em Bob Holberg hhill0ll1'Yl'l' the name nl lhwhhy Hol- herg is nieiitiunecl hy llreck carlets they will tliinlq fit' tl1e greatest Zlll-1ll'tiIllNl half- haclc that ever put un 21 ttnilnrni tin' tl1e hlne anal gulfl. N11 fine who eyer saw him play will ever forget jersey llllll1lJL'l' 27 cr the leatler wlmse LlllSLll'171lSSL'fl loyv alty anfl ctnirage macle it great. Chuck ll1ll'llL'j S eenter position was his alone. lle hacl lltl experiencecl re- placement, anrl had he heen injnrerl it wunlcl have heen safl inlleecl. Chuck canie tl11'fi11gl1 in It ywi11rle1'l11l way. It paitl oft with an lltTIlUl'1llllQ n1entiti11 on the Kll'Sl. all-conference team. livery time Clinck went pn tl1e tielcl tl1e spirit til the wlittle team wmnlcl jnnip even higher. 'l'he cmitrihtitiun to team spirit he was resptinsihle hir was Ullllllgll alfine to keep llilll rin tl1e starting line- ilii Chuck Hartley www N iid? gtg Junkins not much on tackling but he's good at making faces. Sic 'em, Dart And his life insurance iust lapsed H5 if? ,.,.,, 2 5 . 3 W, wg 5 fa Q! W. if gl' as 'S W2 gwzff i Q. Right: Gee thanks, Doc Below: Brownie presents Dr. Hauser with an autographed football 7Ae Qaaliall Banquef The team presented Doc with a iacket Football awards First row, left to right: YV. Holberg, Carter, Dart, Mal- clonaclo, C. Nelson: second row: Coach glocketty, Kaldahl, Vllalsh. Thabes, Klas, Cottor, Hagstrom, Lanplicar. miie Eadfaefdalf Squad Although not compiling a very impressive won-lost record, the basketball Mustangs of T949-S0 played what Coach Joe Jocketty termed a fairly successful season. They finished third in the MPSL and took the tournament consolation trophy out of the hands of Concordia in a brilliant last minute rally 41-38. Bernie Maldonado and John Hagstrom were the heroes of this game as they sank vital points to cinch the game. The Ponies' season record of 5 wins and T2 losses does not give a true picture of their play. They dropped three out of four one point decisions and were only smothered once in league play, dropping a Shattuck tilt 62-38. Said locketty, The boys played up to the hilt with very few exceptions. They were not too hot in the shooting department but excelled in defensive play. Two of the Breck cagers made the all conference team-Bob Holberg and Del Carter. Maldonado capped an all-tourney berth by dropping 21 points against Concordia to pace to tournament scoring race. The Horses put on their best performance of the season at Pillsbury as they played a beautiful control ball game, with every man on the ball, winning 29-22. They defeated a powerful Murray quintet in an early season game 32-28. Generally, though, they were outclassed in their games outside the league winning only one out of nine. Mr. locketty believes he has the nucleus of a good team for '50-'Sl if his four returning lettermen--Glenn Nelson, Maldona- do, Hagstrom, and lock Thabes-with the aid of sophomores Hank Kaldahl, Terry Klas and Bill Carpenter continue to improve as in this season. Del Carter Almost every team has its old pro, that is, a man with two or three years of varsity experience behind him who tisually knows what to do and how to do it when the pressure is on. This year the Mus- tangs were fortunate in having such a inan+Del Carter. As well being good defensively, Del had a deadly out-court shct which was respected throughout the league. Carter proved his prowess by notching a place among the first tive of the all-conference team. Bill Holberg 55555-P Good clutch players are usually few and f.r between, but Billy Holberg was as much as any coach could wish for in tliis department. He made up for his lack of l eight by his sparkling defensive play and excellent ball handling. On top of these he rated among the foremost playmakers on the squad. He was always calm and collected even when the pressure was at its peak. He lzas completed his third sea- son as a regular for the Mustangs. Bob Holberg 4-44444 Playing his th'rd season of vars'ty bas- ketball, Bob Holbrrg was one of the ma'n sparks on the 1950 squad. Bobby, whose w cked jump shot and defensive ball lawking plaved a mejor role in the suc- cess of the 1950 Mustangs, was named to the MPSL all-conference team two years in a row. His ability to steady his team- mates in a clutch gained for him the honor of eo-captain of the squad. Emkezfdall S Chuck Dart If an award were given for the hardest driving, -most conscientious player on the 49-50 squad, Chuek Dart would cinch it hands down. There was never a dull moment while the Crystal Bay Fireball was on the court fcr, as well as being the sparkplug of the team he was its best rebounder and scored well to boot. In this, his second season with the Mustangs, he copped the coveted 'tAthlete of the Month award in February and was co- captain of the team. Bob Cottor Bob Cottor was the hard worker of the 1950 basketball squad. He was a reserve guard and, although his playing time was limited because Coach jocketty used his underclassmen reserves, Bob played deter- mined ball whenever he was on the court, He was a faithful team member, always reporting for practice and working long hours to perfect his style. I Bukeldall ,Claim Right: Holberg leads the rest of the team on floor with n fast sneeze Middle: Carter goes in for a Icy-up shot 21 Scores Don't cry Chuck W-4? s:'f'E':E'l E Ymwi ' h .,.,,.,,A,.A,A,,A A,A.V,: fEE,Q ,,A., , is W 041 Watch him Bobby In 7eam in Nallian ls it good Dart? Muldy scores - ',,' ..... V , ,,Y , , . ': W ' - i pf-::: 5 ' an 2:9 , X S ,, ns i Moab YQ 'First row, lc-ft to right: Straits, Allcrn, B1'ow11. R. Hula- R. lirmvn. 'l'. llriscoll, Hartley, ATCKC-lvvy, Conch lEZ11'l lmzircl, Solillmcrg, S. lflululaarcl, Lilly, N. Smitltg SL'Cll1lCl row: Brczrlill, team manager H. Sommers, Dunn, C. Herbert, McGrath, sawn., Squa The Breck Hockey team started the season with a crew of young, inexperienced, but willing puck enthusiasts, and closed the season with the sincere feeling that things will be better next year. They had a record of five wins as compared with ten losses. They dropped their first four games to Edison 2-0, Minnehaha 3-l, St. Thomas 2-0, and St. Paul Academy 7-0. The Ponies retaliated with four straight in the win margin against Concordia 6-0, Wil- son 3-T, Blake 3-2, and Mechanic Arts 4-3. Minnehaha beat them 3-2 to oust them from the State Prep School Tournament. They slumped again and the following teams knocked them over: Minnehaha 2-0, White Bear ll-5, St. Thomas 6-3. A short relief came when the Mustangs shut out Concordia 6-0. St. Thomas gave the pucksters a 7-2 drubbing in the sea- son's closer. Captain Jim Lilly, Richie Ahern, and Dick Hubbard were awarded positions on the M.P.S.L. All-Conference hockey team. Richie rqfzean Alai' an Zfze had of Iflze puck 95595-y Mani wed 1,5 Where's the puck? Ahern frightening puck Jfackey It 14 Notice McGruth's form The face off f l l Hully Sommers N 1 in-f it jobs possililt- arotintl llrcvlx lt-ch, thgit ot ht-ing iiiztiiatgci' to thc litwlat-y tcznn. Not only tlitl hc liavt- tn take fin thc ntiint-runs jtnlis that wt-nt with lit-ing iiiaiiagt-i', but hc ztlsn hztcl to iiztrtzilic in thc liacltlirczik- ing' husint-ss of slitivt-littg' thc rink. As tlmtigli tht-su tltitit-s wcrt- nut Q-noiigli, ht- wzts zilsfi cztllt-tl on tn talw mx-1' tht- goal- tt-nrling position wht-n tht- gtialic was alm- sont. f Barry McGrath limit lXltt1i.ith taint- tu thc xztisitv tty s . nm nsitx X l Q initnx lt hnn otf w is it 'lf-'tin l'tst wintci' tn holcl clown 'i rlcfcn sin- prisittiii on tht- first hnc. liztrry ini- iiiwvctl rzipitlly as the st-zistnt 1:i'ugi't-ssccl. :intl plztyt-rl it goorl ganit- in thc St'2is0l1lS vltisut' with St 'l'li4minas Jfac Seniaad Chuck Hartley Lihuck llztrtlcy iiitwt-rl intti 21 vztrsits lit-rth with no 1ii't-vitiiis t-xpt-i'1ctiuv on K'llllL'l' tht- vztrsity tn' -itinitwi' vztrsity. .Xl it CUIIICS only tlirougli pi'ztctict-. Liliuvlq put his lic-art into t-:icli :intl L-vt-ry contest. A though lit- latclaccl tht- skating lint-ssc thz mln-tt-iisciiiziii. ht- iilztyt-cl in :tlniost :ill tht gznnt-s ztntl gan- thc sin-t'tzttm's inxinv thrills with his Ct-iiiluiiizttiuii liitttlnall hltwlc :incl litaclccy clit-Clc. Nippy Smith Nippy Smith grzthhcfl 21 wing pnsition tin tht- first lint- t-ztrly in thc sa-:isrin and lu-pt it tlimtigliwiit tht- st-ztsun. Nin hail siwllt tlnx-c ya-airs on tht- vztrsity, :intl hurl :tlwztys ht-cn a alt-pt-iiclztlmlu imlztycii lvlllOl'- tiinzitcly ht- was injitrt-cl towzircls tht- cncl tit' thc st-:tson ztnfl was tinzthlc to pztrtici- imzitt- in zictivc iilzty fm' tht- rt-st tit' thc yt-ztiz NlDllj'.S giiiut-fiilliit-ss :intl sticlc hztntlling was allways it Q11-at :tial tn the iiiickstt-i's. Jim Lilly A vt-i's:ttilc plziycr with at grt-:tt :lc-al nt cniiipt-titivc spirit, lint l.1lly pmvt-fl to ht the s1izti'lqili1g' fit the Mustang' pnvlc Crt-w -lint was ulcctt-tl lay his tt-xtiiiiiizttcs tn cap- tztin tht- sriuful, :intl his wtirk tm' thu tt-:nn soon imwctl ht- was tht- niztn tm' thc juli .Xltlioiigli hc plziyt-cl at thc wing' position it QILAI tlL.1l wt tht tnnt, lit won an .ill ctiiit'c-i't-iic't- ht-rtli as 21 tlt-tc-iisuiiizni. Ht :also wus thc tt-zt1n's sccmitl higlit-st scorn-i'. l l Eaecfa in ' al Ska Meg! Warmee makes a fast turn at the top of the flush in the the Breck Invitational I0-5-4-3-2-l-G0! Starter McGrath gives Warmee the signal while relaying it over his radio to the finish line Number 2 man Morse cuts a closed gate short and fast on the Die Trail l Left to right: Young, Miller, Morse, NYarmec, Barker, Cherue. Sfzi '7eam Hurt by the loss of Ted Cardozo, Breck ski ace in '49, and hampered by sickness the ski team finished only fifth out of nine teams in the annual Breck Invitational meet. The meet was held at Moon Valley on March 4, it attracted 48 entrants, a record number. The teams raced in slalom and cross-country. Breck was defeated again by North High School on March T0 in a slalom contest. The skiers trounced Edison high l2i to T09 to post their only team win of the year. Team captain Sumner Young had the best record with a first place, two second places and a fourth. Letterwinner laddie Morse did well with a third and a seventh place. Nippert Smith grabbed a fourth in the Edison meet. Byron Warmee, Charles Peet and Russel Cherne all displayed definite promise. Left to right: Mike kjfillll. Qcoaclij, Rcmalcl Oppen, bla111cs Lilly, Bula Hollac-1'g, 211141 Robert D11C11si11. Wy 7eczm The loss of three of the first four men on last year's golf team seriously hampered the Mustangs throughout this season. The graduation of Bob Crosby, Dick James, and Chuck Stone left Jim Lilly as the only man with previous varsity experience. Lilly was the number l player on Coach Mike Uram's four. Jim was a good all around player whose scores range from the high 70's to the high 80's. He does his best iob with the woods. The number two man was Bob Holberg who was out for golf for the first time. Bobby, although a little inexperienced, had a good iron game. Both he and Lilly graduate this year. Ronald Oppen in the number three position exhibited a great competitive spirit which coupled with a good iron game make him one of the outstanding prospects for next year. The number four spot was filled by eighth grader Bob Ducusin who shows cr great deal of promise. He was rather inexperienced, but Mr. Uram thinks he will do great things in the years to come. He shoots a score in the low 90's which is very good for a beginner. The outlook for next year is not bright because two of the four men leave and the other two have little experience. First row, left to right: Nhlilsli. Cozicll Dart, Linclszly. Seccmcl ww: Driscoll. Sipc-1'5tvi11, Tlizilncs. Goocl. ennift eam The tennis team switched coaches in mid-season, but they didn't change their winning ways. Early season player-coach Chuck Dart started them off winning. ln mid-season Mr. Hath- away took over and kept them winning. Aside from being early season coach, Dart was also first man on the tennis team. He took his share of victories. Next man was Gary Good. Then came Toddy Driscoll. Toddy and Jocko Thabes were the only two men on the team who were not seniors which makes things looks pretty sad for next year. The team lost only three matches up to this writing. One to Blake, one to Shattuck, and one to St. Thomas which was avenged with a victory. Other boys on the team were Siperstein, Lindsay, Roosen and Walsh. l'1l'OllC row: Cfuacli Ray Cicitovcsc, RugerG1'ec11lxf1'g, Rich- cull, lizirl .'Xr11esm1, Garry iimmcl :incl .lim llwyc-rg tliirml zrrcl gklierii, Paul Haugc, Don Carlson, Shelclou l,c-viiic, ww: 'lbclcl lliiscrill, XYillmr 'lfuslc-i', ldicliarcl Holiulmerg. Holm Cuttor, :incl Cfltarlcs Hzirlleyg sc-coilcl row: licriiarcl Cliuclc llzrrl, bYOUflXYlll'fl liyc-rly, zmcl john Milli-r. llzrlclmizrclo. Dave lilfslrzmcl. ,lolm llzmlcs, Qlflctclier Dris- '7aack '7eam During this, the second season of track at Breck, coach Ray Genovese's charges broke into the win column for the first time in the short life of the sport here. The Mustangs whipped Min- nehaha and Concordia to the tune of 65 5f6 to 50 2f3 to 23. The Breck cindermen were strongest in running events, fea- turing Rich Ahern and Fletch Driscoll in the 100 and 220 yard dashes, Bob Cottor, Paul Hauge, and Don Carlson in the 440 and 880, George Rowell, John Miller, Tim Sands, and Woodward By- erly in the mile run, and Chuck Dart in the high and low hurdles. The relay team was usually made up of Ahern, Driscoll, Cottor, and Earl Arneson. In the weights the Mustangs lose all but one man. Dave Elfstrand, Dick Holmberg, and Wilbur Tusler in the shot put, and Chuck Hartley and Rog Greenberg in the discus all graduate. Driscoll who heaves both the shot and discus will be the only returning weightman. The other field events highlighted John Spider Medelman and Gary Good in the high lump, John Danks in the broad jump, and Del Carter who handled the pole vaulting. First row, left to right: A11-its, Brown, VY. llulluerg, Eyre, hluukiu, Heger, lt. Brown, lilas. G. Nelson, Hage llumi. Xslalcsuti, Meyers, lleecli. sttwmi, Cz11'pc-nic-t'. Cuzicli ltreault. Sc-cmicl row: Xlznizigc-1' Soiiniivrs. llmvell, liit'lcxmocl, Eadedall 7eam lf winning a greater number of games each year is any indi- cation of success, the sport of baseball is definitely on the rise at Breck. ln their first season, the Mustangs failed to notch a win, in the second season the Breck club finally broke into the win column with a victory over Pillsbury, and in this, the third season of the national pastime here, the Mustang nine managed to knock off two of their foes-Shattuck and Pillsbury. Pitching, as usual, was one of the Ponies' strongest depart- ments. At the beginning of the season the hurling was good, but overwork finally caught up with sophomore Al Dunn, the only starting moundsman. Rog Arens, Bill Carpenter, and Jim Brown all tried their hands at relieving, but they were more at home in their regular positions-outfield, outfield, and catcher, respec- tively. First sacker Bill Holberg was the most reliable man in a rather sporty infield composed of himself, George Rowell at second, John Hagstrom at short, and Al Junkin at third. The outfielders proved themselves quite capable in the fielding department. Arens, Carpenter, and Glenn Nelson were the usual starters in the field with Dick Aslakson, Bob Brown, Terry Klas, Jon Meyer, George Heger, and Bill Eyre filling in on occasion. Hitting did not pose a question mark--it simply was not there. The situation looks better, however, for next year's squad. Only three members of the i950 team graduate, and, with an improvement in hitting and a few more days of pre-season prac- tice, the Mustangs could not only win their quota of three but possibly a few more. Hose Things? Snow use says Dick Lilly, Spider ond John or work We Jan 'Z' winlea, qaa can fzafae fzea 04 il' wad a chill wfzen winf Mai flew ad a lol' of fan Ears to yo Marching through Georgia , . ,Lf of H? W EILMQESRYHW A ,fy ' ? ' - Made aaafiifmeu Brown with worries of world upon his shoulders 3 Genovese recalls army days Hartley is the center of attention To the place where Louie dwells Johnson practising for Horace Heidi aalbifa qaaliai Shades of the Alvin H-s 'W 1 Aww, you shouldn't have done it Sing, Carter, sing 7fze fbaamilaay Mr. Genovese, Mrs. Vandewater, and Mr. and Mrs. Olson all were responsible in making the dorm more of a home than ever this year. On this and the two following pages we take you on a conducted tour of the dormitory. And big piece for you Maldonado, boy baby sitter Clip ioint Studying in the dorm Aslukson, you're not going out tonight f25cvwulZ'o2zq .fife Fletch practising to be the life of the party Undercover man Elfstrund working on case I'm not much good in moth, but if you have ony questions about English Olson smiles while checking off loot Don't lough, you're next Qaacfe DRAMATICS Mrs. Plette MODEL PLANES Mr. Breuult CRAFTS Mrs. Halvorsen OUTDOOR ACTIVITY Mr. Olson .Sched fflafzuzizu SWIMMING Mr. Morrill BOOKLOVERS Mrs. B. Brown GAMES Mrs. Hullberg JR. BAND Mr. Plette chem st:1ff.h-fl to right: Ruth XYCi2lI1Cl, Violet PL-ucuck. T,o1'ctt:1 Otto. Chvf Lf. A. 1,1'0llC1fit, Jim Foss, Frieda JOIIIISIJII, Lloyd Duckcn, XVitey Lzumazzo. ww ,eww sag 3 Lindsay and Wegner look over Mr, Proudfifs future fried chicken 'So he suys to me, he says. we X , N , Well, don't just stand there. Do something Muda amz Elfgfrqnd gleepg one out Whut's your excuse this time, Levine? BW .X E You'II march and like it One squirt meets another Toot? ,wzzm me om Buster Brown makes mud love V Q Qld! 25064494 i Member of the Breck Corpse Hair-bruined youth Dick and George check athletic equipment HISTORY Mr. Jocketty if MATHEMATICS Mr. Nelson In Me W,.WW,A,,w LANGUAGES Mr. Krenz HISTORY Mr. Genovese UM lla fdecaacd 6 new-mfivwmi Brownie in action e if in A Hardening of the arteries no doubt Q Lower left: Recording for Decca Below: Ground Hog Day -W, A ., Front row: Ruli l'l0ll1c1'g, Bill llullic-rg, lflc-tclicr Driscoll, Suinuer Yuuiig, Clizirles llzirtlcy, llc-llierl C'z1i'tc-1', zmcl Don Carlson: fvcniiirl row: lim Saticls, Carl llc-rlmert, Slove Sultllmc-rg', lim- Cnlizing Oo. l'gc'l'lT2'll'Cl Klalclmmclti, blmi Xlc-yer. Henry Kalclaltl. zmcl Violin flagstiwnii. Gaclez' This year the Cadet Council raised over 5400.00 through sponsoring a magazine subscription drive. Steve Sohlberg and Tim Sands were co-business managers of the successful fund drive. The sophomore class won the top honors by selling over half of the total amount. The Council purchased awards for the Intramural Boxing and Wrestling tournaments. They set up a committee that will supervise the student lounge operation. This committee headed by Bernard Maldonado put the lounge in operating shape and will continue to do so next year. The Council also divided the class dues money among the class as required by their needs, the most going to the iunior class for the J.S. The council gave Sl00.00 to the Mustang to aid it in its fund raising campaign. The Cadet Council officers were: Sumner Young, president, Charles Hartley, vice president Fletcher Dris- coll, secretary-treasurer. lfirst row. lc-ft to right: blohn Miller, Bzirnzircl BLZLLKLUITZLQLO. Brown, Sumner Young. Jerry Siperstcin, Roger Green- XYrmclw:ii'cl liyerly, XYilhur Tiislcr, licl Carter, Chuck hc-rg, llc-imis Gibson, Paul Haugc, Rhee Chang OO, Gary llzrrt, Torn liocliii, Chuck Hartley, Nippcrt Smith, Riche Goocl, Dexter Lnllcin, Rich Ahern, Dan Frisch, Fletch ircl 4Xslzilssini3 secimcl rowz Dick McNziry, Phil Smith, Driscoll. Not picturc-cl: l.z1rry Linclsziy, 13011 Carlson, Bah Cotter, 'lohn Tlizihes, Holm Roosen, Tim Sands. ,lim Charles Robinson. 7 aqanafz. .fegjan The Honor Legion is an organization of cadets whose creed is based on the four pillars: Scholarship, Leadership, Service and Character. To ioin, a boy must have 75 efficiency points, given for school achievements and the vote of approval by the legion. This group works actively to eliminate cheating and to improve the school in all its phases. The Legion elected John Miller as its president, Roger Green- berg as vice president and Tom Bodin to the secretary-treasurer post. Under the guidance of Mr. H. H. Smith its founder and now high school principal, the Legion drew up a constitution and im- proved their methods of electing new members. To be elected to the Breck Honor Legion is truly one of the greatest awards that can be given a boy. ILITAR Delbert Carter, Captain e Staff Robert Cottor, Captain John Miller, Captain Nippert Smith, Captain Wilber Tusler, Captain Fletcher Driscoll, Sergeant Maior Rhee Chang Oo, Sergeant , ' H' eg, y .lon Meyer, Private Henri Verbrugghen, Color Sergeant Phil Soderlind, Corporal Bill Eyre, Private The Color Guard Company Staff Sumner Young, Captain Gary Good, Captain Richard Aslakson, First Lieutenant Roger Greenberg, First Sergeant Bill Johnson, Corporal A Company, usually composed of the older, more experienced cadets in the battalion, was this year organized on an equal basis with Company B. The younger members of the company soon proved themselves able soldiers, however, and they car- ried on the A Company tradition like seasoned veterans. Leadership in the company changed midstream, but Cadet Captain Sumner Young finished the year as commander. He was supported by Cadet Lieutenants Dick Aslakson and Chuck Dart, who, as platoon leaders, kept their men in top-notch shape throughout the year. Their work was largely responsible for A Company's fine showing during the annual government inspec- tion. Cadet Lieutenant Gary Good, second in command of the company, and First Sergeant Roger Greenberg were also key men in the company's success. A Company we vm:' ewfxleli Mt is 5.. N X S . M' W ggmgq Q igwigmyf, Qggzsgi Q fa I 5 is we M51 mx, mamma WH WWW 52!5i??iSrSe5S85lS5?M ,m,,55,,...,9,e Y aww 'ESSBQSSWI e-am i ' A olhpan Staff Phil Smith, Captain Charles Hartley, First Lieutenant Woodward Byerly, First Lieutenant Bill Plummer, First Lieutenant Jerry Siperstein, First Sergeant Bob Beaubaire, Private A snappy unit in a snappy corps-that defines B Company, second only in alphabetical order. Whether on the march, in combat drill, or at inspection time the members of the company went all-out to look their best. Neatness, discipline, and preci- sion were among the assets maintained throughout 1949-50 by the company. Like Company A, Company B underwent a change of com- mand midway in the year. Cadet Captain Phil Smith became com- manding officer near the end of March, and he molded a unit of which any cadet would be proud. Cadet Lieutenants Chuck Hart- ley and Bill Plummer served as platoon leaders and they, to- gether with Cadet Lieutenant Woodward Byerly, second in com- mand, and First Sergeant Jerry Siperstein, were important figures on the company staff. B Company 555594 ,- M wgw, W A:,.g 'H ww ., Lf, S 4 W 4 Q si ai. 'llliihww ' SQQSJFW' 2: , ' wmsma: .,f:' , 5 iwmwaw W ,www ww , , .J . -Mila, ,W Y gunman if ', , 1 5 W M1 wg 'lim ay ii 2 E S i E 3 3 3 Z I an ax i 2 S 'YF E? 5:0 FQ 52 Q 32 3 , E 1 K Middle school cadets form Breck's second battalion. Cadet Major Peter Madden is in command of the outfit, which trains students for membership in the high school corps. The battalion is divided into two companies, led by Cadet Captains Don W. Johnson and Otto Brunke. Johnson was ably assisted in C Com- pany by Cadet Lieutenants Don Hawkinson and Bill Shapiro, Second attalion Peter Madden, Captain David Strate, First Lieutenant Harris Levine, First Sergeant Murray Goldstein, First Sergeant Marvin Bloom, Sergeant Ed Koch, Corporal while Cadet Lieutenants Don E. Johnson and Bob Thatcher aided Brunke in Company D. Cadet lieutenant Albert Schultz was second in command of the battalion. The grade school battalion has shown signs of being a good preparatory organization for those coming up to the high school next year. R Above: C Company om-N f V WN F 95, , . Grade School ilitar Below: D Company Zf?'?: ' X tw 'Mm '- w .. if W , V 8. 'ix ' M 5, st '43 I ZJAWU 40 5 .-'- ' '... .,,. ,..A J AA,. 1 as . W ', . if ,sv A . N A.-is I x 4 , ,5 ' A W i nil? 1 ' Q 2.1 W Q' 35 X ' , 1 4 is A . 3 2 We as 'el A 2 4 9 '?'i,,:, lintcrecl 1948, Z years: l'.l .C. 33 Sergeant 43 Baseball 3, -1: Swimniing 31 Riding 31 Typing 3. 4: Auto Mechanics 31 Cavalry 3, -lg Air Corps 33 Rifle Team 45 Intramural Basketball 4. : a ag -5 47 - -,1,F:.-....-,.....:-.-.-.- -ffiififfiiF9: -1ii?E:ii2::..-e:::.!::.-!:::sues 'zzz11212521-----.-f..1.1--...-.------ .- . It was once said that if Roger Arens quit smok- ing the cigarette industry would fold. That may be true, but there is more to Rog than nicotine. Rog has been a boarder during both of his years at Breck. When not boarding he may be found roosting in the small town of Dundee, Minnesota. If that town is everything that Rog claims for it I don't see why anyone would want to go to the circus when they could go to Dundee. Because of heart trouble Rog's athletic activities have been confined to baseball and breaking arms with Dick Aslakson. His Charles Atlas physique can be seen on the pitcher's mound in baseball. He may be seen breaking arms and furniture every other Thursday and Tuesday with Dick in the dormitory. In the humble opinion of this biographer no one in the senior class has made the tremendous improvement in two years that Rog has. Not that there was anything wrong with him in the first place, but everything can be improved upon. The degree to which Rog did it was amazing. i' 'k 'A' 'A' linterecl l948, 2 years: Corporal 35 Second Lieu- tenant 45 First Lieutenant 45 Varsity Basketball 3, 45 Baseball 45 SVVl1TllI1lllgQ Glee Club 35 Mustang' 45 Mustang Advertising Manager 43 Military Ball Committee 45 Chairman Senior Concessions Com-mittee 45 ,I-S Committee 35 Good Conduct 35 Honor Legion 4. e- 5- E 1 2 - - -- --. ---. -'J 5 . I - , 5,...,Q-:,J,,,u,,,,2,i5,,5: i,,,::'-i5::.::'.?:z.r.:2nY: .- - -- .--- v.--.-.-..-.-.- V Y ---V ar--.afirar - 'fZFEZi?5?ifZ ?iF'i Breck School and Edmore, North Dakota have one thing in common: Richard Aslakson. During the summer Dick works on his farm, building up that already good set of muscles. There are three good reasons for his having muscles during the win- ter. First and perhaps foremost is to impress a cer- tain gal that lives in Excelsior, for Dick comes to all dances without fail. No more need be said in regard to women. Second is self-preservation in the boarding department where Dick has been a boarder for the past two years. He also holds the 'A' 'A' if 'Ir unofficial arm-breaking championship of Breck School in conjunction with Roger Arens. His third use for muscles is in athletics. Dick is a two-year man in basketball. He played football in his junior year until he broke his shoulder. Baseball was an- other athletic accomplishment. In his spare time he became a member of the Honor Legion. He jumped to the rank of lst lieutenant in military in just two short years. Pretty good. Come to think of it he did pretty well in everything in the space of just two short years. lfnterecl 1943, 7 years: l'.F.C. lg Lance Corizoral 2: Corporal 33 Sergeant 43 junior Yarsity limit- ball 2, 3: Varsity Skiing 33 Varsity Golf 45 llon- or Student 2, 3, 45 Class Scholarship 1. r :uni-1 :un - 1 -f.-v------.llgil----,-.TE2. -1 AA . vnu 1.1 1- -1111111111'n7:iz1iE:E4?ii7iE2JZ7iE' va: rn lnggg l4g444l 4411114 A quiet lad by nature, Bill Barker loves the great outdoors. He is very interested in all forms of wild life, particularly birds, and he spent Easter vacation in Northern Minnesota and Canada on a camping trip. He was hunting the bald eagle, a species be- lieved to be extinct in Minnesota. A charter mem- ber of the Breck bag-lunch crowd, Bill provided his fellow lunchers with many tales of his experiences during the hunting season. He is considering for- estry as a career. Bill is also an ardent skier, and winter is sure to find him schussing down a snowy slope. He was quite active in both varsity and intra- mural skiing during his high school years at Breck. Militarily speaking, Bill advanced in rank each year. Bill's interest in military and his sterling perform- ance as guide sergeant of second platoon, B Com- pany, have made the corps a better unit. Bill is one boy who is almost certain to be a success when next the senior class meets, for his methodical work is sure to benefit him. 'A' ir i' 'k l lintered 1940, ltl yearsg l'.l7.C. lg Lance Corpo- ral Z: Corporal 3: Sergeant 4: Bugle l, 2, 3, 4: Bugle Editor 4: Mustang l, 2, 3, 45 Director of the Breek News Service 3, 45 Class Treasurer l, 2, 3, 4: Basketball Manager 35 Director of Ath- letic liquipnient 4: Junior Varsity Basketball 25 junior Varsity Football Z, 3: F-S Committee 25 J-S Committee 3: Homecoming Committee 43 Public Address Announcer 4: CO-chairman of Concessions 4: Christmas Ball Committee 35 Intramural Basketball 3g Unit Citation lg Per- fect Attendanee lg Class Scholarship Award 2g Honor Legion 45 Secretary-'l'reasurer of the Honor Legion 4. - 1 - - .. i .. 5 - -.g' -,,---1....-.. .,--------. --fii!'iEiii5EE5ei5E5--.',.. s5:.zr::L:.e:::ses.' 'I'rusty Tom Bodinw during his four years in the high school has probably handled more money than Morganthau. Tom has been class treasurer during his freshman, sophomore, junior, and senior years. Being Managing editor of the Bugle is only another of the many journalistic feathers in his cap. Tom is going to take journalism at the U. of M., and to get a background for his Work he has worked for the Mustang and Bugle for four years. The only one of Tom's stories ever entered in a contest gained 'lr 'lr 'lr 'lr second place rating in the state contest. This year Tom was also made Managing editor of the Bugle. His work on the 'SBNSU in keeping the newspapers and radio stations in the cities associated With MPSL informed of MPSL game scores was very Well done. During his junior year he was manager of the bas- ketball team. Besides these many material aids to the school his fine sense of humor Won't be forgot- ten. If you need something promoted heill volun- teer to promote it, and he'll do a darn good job of it. lintered l945, SM years: l'.l .C. li Liince Corporal Z, 3, 45 Staff Sergeant 43 Second Lieu- tenant 43 Executive Officer of B Company 4: Fencing lg Softball Z5 Tennis 1, Z: Swinnning 2, 35 Track 45 Senior Concessions Committee 4: Homecoming Com-inittee 4: Military liall Coni- inittee 4: Crafts 13 Genealogy Z: Travel an-,l Science Club 23 Oratory and Debate 23 Science Club 35 Draniatics 43 Bugle 1, 4: Mustang 1, 4: Bugle Associate liclitcr 4: 'l'yp'ng 43 Perfect Attendance 3: Good Conduct Medal 3: Cn't Citaticn lg Grade School Awards Medal: Class Scholarship Avviprd lg Honor Student: Honor l effion . 5. .. 4 ll --- ,- E: :I Z 711 I - 1' - 2 :2 - -v-..-.-JL---.-f.-- i'Ei3F nTFZi:F3ZFiEiE1iT1nFiFii'ifiiiiriggf'-12523552555 --,--,-,i,....--.,..,...-..-..---,i,--1-.3--5-,-1:4314-A-11,411,1141 Having been at Breck for six years, Woodward has certainly left a mark in the improvement of the sihool. He has consistently led his class in scholastic ability. This year he ranks one of the first in the class of ,5O. He has participated to a great extent in extra-curricular activities. He is on the journal- ism staff and has participated on numerous com- mittees for class functions. During every home foot- ball game he served loyally on the senior concession stand. Woodward is a member of the Legion of Honor, an outstanding organization at Breck. When it comes to dramatics, he always takes a part, such as in the Christmas play and in the senior skit at Christmas time when he took a leading role. Any- thing which he undertakes is done willingly. He is planning to take up a pre-medical course at Macales- ter College. During the past several years in ath- letics he has taken swimming and tennis. The fel- low who has not heard Woody's,' clever and in- genious remarks-his wonderful sense of humor- certainly does not go to Breck. i' xl' ik 'A' linterecl 1939, ll yearsg P.F.C. lg Corporal 23 Sergeant 35 Zncl Lieutenant 4g J.V. Football l, 2, 3: ,I.V. Basketball 1, Z, 35 ,I.V, Boxing 23 Bugle l, lg Glee Club 4: Crafts lg Class Schol- arship Award l: Good Conduct 3: lCffic'ency lg Perfect Attendance lg Unit Citation lg Cadet Council 45 Honor Legion 3. f 5. .A - :- - at 'A I - .,,. - ,Yg!5!g15gg' -gggggggfgQg:gi: .g':ur.r4l:4i1x'1n'EFFCZfiT':i11vi':LFE47r'i72 11:59:51:-tri:-gnagrgzaigzxzrgzri-TU 7: ia:'77i1Z5'f' f 'Z'iF5'f2'7i7ii One of the most interesting facts about Don Carlson is that he has been at Breck more years than any other cadet. Don entered Breck in the sec- ond grade, and has been an outstanding member of the corps ever since. He has become interested in almost every activity the school has had to offer. He has participated in many of the sports at Breck, but became most prominent as a boxer. In his soph- omore year he became a member of the varsity box- ing team, and made the trip to Mexico, Missouri, where the team had a match with Missouri Military if 'A' i' ir Academy. He has played a great deal of junior varsity football and basketball. Don is a charter member of the Legion of Honor, and has been an outstanding member of that organization since it began two years ago. In his senior year Don was also appointed by the military department as a member of the student council. He has shown a great deal of interest in military, and this year he worked himself up to the rank of second lieuten- ant. Entered 1944, 6 years: Corporal Z3 Sergeant 33 Second Lieutenant 4: First Lieutenant 43 Cap- tain 4: Crack Platoon Z, 3, Cadet Board 4: Student Council 4: Honor Legion 3, 4: junior Varsity Football 1, 2, Varsity Football 3, -it Varsity Basketball l, Z, 3, 43 All Conference Basketball 3, 4: Intramural Boxing Champion Z: Crafts l, Z1 Military Ball Committee 43 junior Senior Ball 3g Homecoming Committee 3: All Intramural Basketball Team 13 Activities Award Z3 Class Scholarship Award 4: Distinguished Service 2: Unit Citation lg Perfect Attendance 1, gl Best Corporal lg Good Conduct 3: Best Squad Award Z3 Varsity Baseball 35 Varsity Track 4: Freshman Sophomore Dance Commit- tee 25 Student Lounge Committee .23 Swimming 1: Horse Show Award lg Glee Club lg Chess Award 1. I U e g , O '. I 1 - - 1 - E - 111 .-5- 1iiiiiiiiil-5.'Hii!!El'?'aiezszg Perhaps the busiest person in the senior class and the whole school is Delbert Carter, for he has par- ticipated in practically everything that goes on at Breck. He has had many jobs and has accomplished much during the last four years. A fine leader, Del was promoted to major, the highest military office of the corps, this year and has done much towards the improvement of the corps. His amiability and sense of responsibility made him well Htted for this job. He was a member of the Breck Honor Legion 1 I and was elected there in his junior year. Del has been on the varsity football team for the last two years and did a swell job at end. In basketball he has proved to be an invaluable player. He has been on the varsity team all of his four high school years, and he has the desirable faculty of being able to take almost any position on the team. He also is an intra- mural boxing champion and an all-conference man in basketball. 'A' ir 'A' 'A' lintcred 1943, 7 years: l.ance Ccrporfl l, Z, 3: Corporal 33 Second Lieutenant 45 Capta'n 43 Chief of Battvlion Staff 43 j.Y. Basketball l, 2, 33 Captain -I.Y. Basketball 2, 35 j.V. Football 2g.Captain lntr. mural Football 2: AlI-'Iiourna- ment Intramural Basketball 3, 43 Varsity Foot- ball 3, 4: Varsity Basketball 45 Track 2, 3, 4: Military Ball Committee 1,43 Finance Chairman Military Ball 4: Honiecoming Queen Commit- tee 4: Bugle lg Public Speaking 45 Genealogy 25 Most Improved lg Unit Citation lg Good Con- duct 3: Ca in Fch l'xs1'c Medal li Top Class Scholar Z, 3, ig Craf: Platoon 2, 3g Honor Student l, Z, 3, 415 lloncr Legion 3, 4. L - - ' 5 ,- a -.:L':!L':L'52i'Ii!5!:. Jdl 2!:!2!:!2 -.... -,..-.,....-.......-.....-v...... One of the boys who has rolled up one of the most varied and longest list of accomplishments at Breck is Bob Cottor. Academically, Bob has placed at the top of his class for the last two years, and this year that goes for the Whole high school as Well. He has consistently placed high on the honor roll throughout his four high school years. Athletically, Bob has primarily been interested in football and basketball. He was a hard Working end and always gave extra effort on the varsity squad. In his Hrst year in varsity basketball Bob worked hard and if if 'A' 'A' came along nicely at guard. Bob received good marks in his military also and held a position high up on the staff. He is a charter member of the Hon- or Legion, having been inducted in his junior year. Whether it's solving one of Iohn Nelsonis trigonome- try problems, or putting forth his effort into some sport, you can be sure that he is vigorously doing his very best. Bob plans to go into medicine, and he is scheduled to take his pre-med course at Macalester College. linterecl 1945, 5 years: Corporal 33 Sergeant -lg Second Lieutenant 43 junior Varsity Football l, Z, 33 Varsity lfootball 4: Band 1, 2, 3, 41 filce Club l, Z, 31 :Xrt l, 23 Vuit Citation 25 Class Scholarship Z. S 5. a:: 5- A , - 'FEEE 5 7f1'Hi7Zfiigfiififfififig --5sgezssgzz il..!:!:.:::::::r:::::a':!:n' -- 1 'A5fii21'Z--?'q' 'ff 'fn' -- - '-' ' zzz:-:: '1' -v4.-e:' 1e:z: i':::r:s1 . A'Well, how about another cartoon on the board, Luke? asked Mr. Genovese one day in his senior social studies class. Who could forget the look on Mr. Genovese's face as Bob finished his drawing? For, on the board, a likeness of Mr. Genovese Csomewhat distortedj grinned at the class. Well, Mr. Genovese is certainly not one to let Bob get away with that! f'Give me that chalkln he fairly howled at Bob who gave it to him expecting to have it shoved down his throat. Instead a minute or two later, whose face should appear on the black- board but-you guessed it-Bob's. But g'Luke dish- es it out and takes it with equal ease. This quality makes him pleasant to know and an asset to the many school activities in which he takes part. These include playing a bass drum and cymbals for the band, in which he holds the rank of sergeant, varsity football, on which he held the position of defensive guard during his senior year, and a couple of years in the glee club. When asked about outside hobbies, Bob answered briefly, Women.', i' 'A' i' 'A' lfntered 1945, SM years, P.F.C. 13 Lance Cor- poral Z, 3, 45 Fencing l, Tennis 1, Z3 Softball 1, Z3 Swininiing 2, 33 Track 43 Senior Conces- sion Committee 45 Homecoming Committee 43 Military Ball Coniniittee 43 Newspaper 1, 41 Yearbook l, 4: Newspaper Associate Editor 4. E 5 5 'A . '5Y!E2'2.?: T' -Ya!!! . i -FI!!! . . S'EL!'!'.l9.ll!JdL'2'lwIiZ'!:'!--: As soon as the snow melts and the track team be- gins training, one can Find Iohn Danks at the broad- jumping pit. Iohn became interested in the sport as a junior, and made his first showing at the Shattuck Invitational meet. This year he took advantage of an advanced track program and was a steady com- petitor. Not a natural athlete, Iohn won his track laurels through his own hard work and concentrated effort. It was never uncommon to see him trying to perfect his style long after his teammates had re- tired to the showers. His determination to improve 'A' if 'k 'A' and learn, coupled with an extreme distaste for los- ing, gave him a decided advantage over his less- industrious opponents. Outside of school, Iohn de- voted a great deal of time to his hobbies. He is es- pecially proud of his extensive stamp collection and of his collection of Time, Magazine covers. Al- though he is characteristically a quiet lad, Iohn has often revealed a keen sense of humor. His witty re- marks have brightened many a gathering of Breck boys, both in and out of school. linterecl l948, 2 years: Lance Corporal 3: Ser- geant 4: lst Sergeant 4: Varsity Football 3, 4: Varsity Basketball 3, 4g Basketball Co-Captain 4: Varsity Track 3, 43 Varsity Tennis 3, 4: Captain Tennis Team 4: Intramural Sking Champion 33 Intramural Basketball Coach 3, -lg Bugle 45 Good Conduct Bar 33 Christmas Dance Committee 31 Hotmecoming Committee 3: JS. Committee 33 l.eadership Bar 45 Honor Le- gion 4. Y 5- Gi E S. T ir'--1-pxvw-r1J - 1 a ,-!.-::!:::2::u:z:u::::g: v:'E7i-Ui fiffiififii Z -Av.. .--,'-----.--.-v - f-..az':l-.--Evazi-.Gaza Basketball, football, tennis, track, Mary, Iane, and Sue. If he were a bigger success with women or in athletics will never be known. Chuck Dart, the good-looking fellow who came to Breck from Deep- haven two years ago, was an asset to every athletic team he was on. His kick-offs and line-backing in football were terrific. He was number one man on the tennis team. No dance at school or anywhere else failed to have Chuckles,, there except during the hunting season. Hunting is his first love. He even brought a few birds to school so the teachers could eat. If Chuck had any enemies at school he managed to keep them well-hidden. Chuck has per- sonality that you canit help liking. His school activi- ties include the Honor Legion and the newspaper. During his junior year he was a boarder, and he boarded for awhile during the winter of his senior year. Chuckls plans for the next four years include the University and more women. That's if l'Doc,' can't talk him into coming to Breck for a post- grad course and more football. 'k 'lr 'A' 'A' Entered 1948, 2 years3 P.F.C. 33 Lance Cor- poral 3: Sergeant 3g Second Lieutenant 43 Cav- alry 3, 45 Junior Varsity Hockey 33 j.V. Foot- ball 3, 4: junior Varsity Basketball 43 Intramur- al Sports 3, 43 Tumbling 43 Varsity Track 43 Swimming 33 Efficiency 43 Riding 3, 43 Horse Show 3, 43 Dance Committee 3, 4g Junior Senior Prom Committee 33 Military Ball 43 Senior Privilege Committee 4. 5 i . 4 : -. I - A v.-----, -.-12535, -.. -1- - ...sm-5fy,,,..-1.'!,,n-5954-15, ,,,,,,,5 'iiiijfii-gf . 'litfiiiii-T?fi' iEi!ff5?2 2i'1C'A!'!S1' i-12 - - . - Ever since Iim has been at Breck he has been in- terested in and has Worked faithfully with the corps' cavalry outfit. During his senior year Iim was a crack second lieutenant who kept the cavalry in high spirits and in good order all year. Those who have watched the many practices for the military revues or the military inspection know the sparkling addition the cavalry was to the parades. The job of keeping this outfit looking sharp at such military functions is partially through Iim's undertaking. 'A' if 'lr 'k Iim has Won many friends during his years at Breck Tech, and has impressed all those around him with his beaming smile and cheery voice. Being friendly to others seems to be one of Iimis best traits. His quiet, calm nature has placed him in high regard of the members of the cavalry as Well as his class- mates and his teachers. He is a good rider and his favoritism for horses is one of the reasons for his joining the cavalry. Boys like Iim have helped bring the cavalry to the high standards it now enjoys. , linterecl 1942, 8 years: Corporal l, 2, 33 Scr- geant 4: junior Varsity Football lp Varsity Football 2, 3, 43 Best Defensive lfootball Play- er 4g Track 43 lntrainural Boxing Clianipion 1, 43 Boxing Llub 1, 2, 35 Unit Citation l, Z3 Dormitory Leaclcrship l. A -- -A .. - :as -,-.-,-,-. nts-- --.-.i1i5::'---, -. -.::u:.'::u:: 1e::::::: 1e? e:r- ---1-I '4v11vA'l1uAl-. 414744 ':': Moooooooose!' That bellow heralds a school character. Each time you hear it if you looked around you could find a big blond Swede with a befuddled grin on his face. Dave was one of those fellows who made the long days in February just a little bit more bearable. Dave was Breck's version of Leo Nomellini. After a lot of work with Moose, Doc Hnally got what he was looking for--as rough a football player as you could face across the line. Dave just loved to splatter other football players. He was also an intramural boxing champion. Dave has boarded during all his years at Breck and has managed to give many a master in charge of the dorm a few extra gray hairs. Moose didn't go out socially until his senior year, but once he did start he went at that in a big way too. Sometime some- body should go up to Daveis home town of Lind- strom and see if the women are everything he claims for them. By the way, does anyone remember how Dave scraped up money for his Model AP Rumor has it he sold the dormitory. if ir 'lr 'k lfnterecl 1945, 5 years: 11'.l7.C. 1, 23 Lance Cor- W poral Z, 3, 43 Bugle l, Z, 4g Mustang 45 Honor Legion 43 llonor Student l, 2, 3, 4. a a . 2 - 'A ' - F ' ' -'::e:J: 1 '-zluz.:sue: 1'- -.::2::u 1':-l '::.: '-! l'a gain.:-.Af--,--. ..-A-.-1-- .A V--.f.-1--1--.u .-.. l'Well, it would more likely be Kerensky in that situation, for he . . f' This, of course, would be Daniel Frisch expounding one one of the thousand and one subjects with which he is familiar. Dan is one of the top scholastic leaders of the senior class and is a veritable fountain of wisdom. He has con- sistently placed on the honor roll his four high school years. He is always first to answer in full de- tail some question or give a definition of some sixty- four dollar word in English class. His knowledge of history and current affairs kept his fellow students ik ir i' 'k and teachers in continual amazement. Dan has been a faithful worker for the department of publications throughout his high s:hool years at Breck. Writing for the Bugle and selling advertisements for the Mustang took up a considerable part of his time. Dan was always ready to help wherever he could for the paper and yearbook. During the winters he usually went out for boxing, and he joined the Breck boxing club. Dan can often be found dis- cussing some weighty topic with a faculty member. l':l'llk'l'Cil 1940, -l years: l'.l7.C. ll Corporal ll l'irst Sergeant 23 Second lieutenant 33 Ifirst lfeutenant 3, Captain 43 Cavalry l, Z, 3, 43 Radio 3, 4: Cilee Club 4: Best Cavalry Cadet 2, 33 Cicod Conduct Medal 33 No Deinerits 31 Class Scholarslrp lg Track l, 33 Riding 1, Z, 3, 4: Honor Legion 4: Military Hall Committee 41 Cadet lioiird 4: Honor Student 45 Cheer Leader 1. i , : , es: .e-- IZ1 l .-f.u1--- zu:-E. -rZ--,1..E5.a---1.-s-.--.-.-.-..,. ': '7i.lL7iE:Ti ?i!. ?:-:z..2': !:!szs:f.e-.e:::::gs:- During his four years at Breck Tech, Denny cer- tainly has been one of the mainsprings of the caval- ry. He obtained the rank of first lieutenant last year and is one of the ablest officers in the battalion. He is a member of the communications club which have put on several plays in the past few years, and he worked consistently on the senior concession stand last fall. 4'Gibby', is also a member of the glee club and was inducted early this year as a member of the very influential organization, The Legion of Honor. One of the more social wheels, Denny,s taste in women seems to be pretty sharp. He has come to all the dances and all the other school func- tions. Many people do not know that Denny has a very unusual hobby, that of antique cars. He is one fellow who is really well-liked and who has added much to the senior class. He is always willing to help anyone, and everything that Denny undertakes is done with a will. His influence at Breck will be missed in the years to come. i' i' 'lr 'I' lfntcrecl 1943, 7 years: I'.F.C. l, lg Lance Cor- poral 33 Staff Sergeant 43 First Sergeant 43 Efficiency lg Best Squad 13 Unit Citation lg Class Scholarship lg Good Conduct 35 Photo- graphy lg Typing Z3 Bugle 4: Mustang 41 News Service 45 Boxing Club 2, 35 lntralnural Boxing Champion 23 Secretary Boxing Club 33 Junior Varsity Basketball lg Junior Varsity Football 25 Varsity Baseball lg Varsity Football 3, 43 Track 4g Honor Legion 45 Vice llresiclent Hon- or Legion 4: Honor Student 4. 3 .e , i - - 1 I 5 E 9 --,-gli Q,--E---,A-LA-3-ivygflgggvgfgggzir-fv.r.u uev.:fr.-. Angggggllilggggggggggggnwunulgig-1:3313 0 FE5f5fir1'i5fi'F i- H. v -----..---...-1--.----.,-...--------. 'A' ' 1 9 - HI-Ie's a heck of a good kid! That phrase fits Roger Greenberg perfectly and it has often been applied to him. Roger's personality is hard to de- scribe. Hels just plain amiable. His enemies are as hard to find as passenger pigeons, maybe harder. Perhaps the fact that he never finds fault with any- thing or anybody explains it. At any rate his person- ality has gained him many honors around school. Hels vice president of the Honor Legion. A check into military shows that he is a staff sergeant. Many of the pictures in this book can be credited to Roger 1? 'A' 'A' 'lr and his hobby of photography. Roger is both a Bugle and a Mustang photographer. The only time anyone ever found Rog nasty was when he faced him when Roger had on either a pair of boxing gloves or a football uniform. Rog was a line-man in football, and he was a good one, too. ln boxing he was an intramural boxing champion in his sophomore year. By gosh, he is a heck of a good kid. If he keeps on going at this rate there will be no stopping him when he gets out of school. Entered 1941, 9 years: Private ll Corporal 2: Corporal 33 Zntl Lieutenant 4g Varsity Tennis 1, 2, 3, 4: Honor Legion 4: Honor Student 1, Z, 3. 45 Tumbling 2. ,L l lt .lil J.. f 4 .2 - 5 'S' S4 g l' - - , -,-11-.-i.- 5 --.-. 5Fi52 in7EFEE5iF'-'--1511555-gr.- g5!ggg!5 .f---.--,--Y.-..-.-.-.-V.--.-.., .- , L'A.A2 ' f Q Q. In Gary we find one of the Well-rounded boys in the senior class. He excels in scholarship, military, and athletics. Gary ranks about fourth in his class scholastically and has always placed either on second or first honors. In military he has attained the rank of first lieutenant and certainly is a very good of- ficer. He is the executive officer of Company A. Gary's athletics have been concentrated mostly on tennis where he has been on the varsity since his sophomore year. He was number two man on the tennis squad this year. Another hobby of Gary's is music. He has been in the glee club for three years and has a Fine singing voice. Not only can he sing, but he also has a very great talent for the piano. He has played many times during the year for dif- ferent events. Gary became a member of the Honor Legion last fall. Aside from school he took part in a ballet in 'The Great Waltzn which was staged in St. Paul. Anything that Gary does is done Willing- ly and voluntarily. 'k ir it it li ll lintered 1940, 10 yearsg l'.I .C. 1: Lance Cor- poral Z: Corporal 2, 3, 41 Second Lieutenant 4: lfirst Lieutenant 4: Varsity Football 3, 4: Hon- orable Mention on MPSL All-Conference Foot- ball 'I'eani 43 Most Improved Football Player Award 4: Varsity Hockey 45 Varsity Track 3, 43 junior Varsity Football 1, Z3 Intramural Box- ing Champion lg Manager of Boxing Team 1, 23 Boxing Club l, 2, 35 President of Boxing Club 33 Swinnning 1, Z3 Vice President of Class 2, 3: Secretary of Class 45 Student Council 3, 4: Vice Chairman of Student Council 43 Honor Legion -lg Newspaper l, 2, 4: Yearbook 43 -lournalisni l'romot'ons Editor 4: Christmas Ball Commit- tee 43 llest Squad lg Unit Citation lg Perfect Attendance lg Class Academic Citation lg Gene- alogy 23 Typing 3, 4g Social Coniniittee 1. ' if 1 g- g, F -, 1 E - --- ,-- --.-.--:.1... . .. 5 1 ' !EkL! Z!'1!.!2!J2!:E2!l?5.V22 32'':5:'J:::'l5':::lJ::5i 5' -, ,di--, ,,, , , ,,., m,u,.,l,.,.- -1- li2::-1..,-,---.--.-..-. .5i.-- - Chuck, Everett, Charles, Chuckles, Evie, and many other names too numerous to mention all bring you the jack-pot when you call them around Breck School. He was a two-year letterman in foot- ball. His play during his senior year was rewarded with an honorable mention on the MPSL all-con- ference team. Chuck was center out of the T. Chuck Went out for hockey for the first time in his senior year and once again starred. Intramural boxing found sophomore Chuckie as one of its champions. He also starred outside of athletics. He was vice- president of his class during his sophomore, junior, ir ak ik 'A' and his senior year. In military he jumped from cor- poral to first lieutenant in one year. He belonged to the Honor Legion and was a member of the Student Council. Iournalism profited by his presence during Chuck's freshman and senior year. He did an excel- lent job as promotions editor of the Mustang raising nearly a thousand dollars for the book. Chuck Was everywhere. Decoration committees and clean-up committees are old stuff to Chuck. In fifty years you may forget a lot of kids but you'll never forget Chuck. lintered 1946, 4 years: P.l .C. 1: Lance Corpor- al Z: Corporal 35 Sergeant 45 Best Corporal 32 Best Squad l: Citation lg Efficiency l: Good Conduct 3: Perfect Attendance 1. 23 j.Y. Bas- ketball Z, 35 Track 4: Softball 3: Glee Club l, 2, 4: Typing 3, 4: Senior Concessions Connnit- tee 4: Class Scholarsliip lg Honor Student lg Honor Legion 4, e Paul I-Iauge's friendly smile and winning per- sonality have made him one of the most popular members of the class of 1950. A soft spoken cadet, Paul was far from inactive at Breck Tech. His clear and true baritone voice made him an outstand- ing member of the glee club for two years, and he was a member of a fine quartet in the spring talent show. His talents are also well known to the Wash- burn girls, his principal social interest. Paul lettered in junior varsity basketball in his junior year, and he was a valuable asset to his class in several of the annual intramural basketball contests. Hauge was a sharp cadet throughout his high school career. He was a member of the best squad in the battalion as a freshman, and he was named as the corps, best corporal in his junior year. Paul, who hails from Dennison, Minnesota, has been a boarder during each of his four years at Breck. His friend-of-alll' manner and easy-going attitude earned for him the Breck Buglels Boarder of the Month award in December, 1949. 'A' i' 'A' 'A' lintered 1944, 0 yt-arsg Corporal 13 Sergeant Z3 First Sergeant 33 Second Lieutenant 43 First Lieutenant 43 Captain 43 Football 1, Z, 3, 43 Captain '50, All-MPSL 2, 3, 43 Basketball 2, 3, 43 Captain '50, All-MPSI. 3, 43 Boxing 1, Z, 3, 43 Captain 7501 Baseball 1, Z, 33 Golf 43 Typing Z, 43 Class Secretary 3g Military Ball Committee 4: J-S Connnittee 3g Cadet Council 43 All-Tour- nament Intramural Basketball lg Unit Citation 1: Best Athlete 1: Good Conduct Bar Z3 Athletic Medal l, Z, 3, 43 Class Scholarship 43 Most Valuable Football Player 43 Leadership Bar 43 Fourragere 3, 4: Color Guard 1, 2, 3: Social Connnittee 23 Christmas Dance Com-mittee 33 lntraniural Basketball Coach 23 Swiinniing 13 VVoodshop 1. .i. - .1 E E I 2 2 ' --,-- --.ill-.- -.-. .-l' 5 -.5,:,,5,,,,i,-,Hi -.J15i1A1::::ir::.:: -,.'AA2Al- Y ' ,-..-,... ,--,-,.,-..-. A winning personality and an incomparable ath- lete are a couple of the many characteristics that make up Bob Holberg. For four years he has been a competitor in many different sports and has amassed a phenomenal number of letters. Football is his big sport and Bounding Bobby has been the sweetheart of Breck football followers since he was a freshman. While operating from left halfback he set a record by becoming the only player in the his- tory of the M.P.S.L. to be all-conference three times. Basketball and boxing take up his winter months. ir i' -A' 'A' He won three basketball letters while playing guard with his brother Billyg in his junior year he was an all-conference selection. Bobby's record as a boxer speaks for itselfg he has lost only one fight in his high school career. Athletics are not Bob's only in- terests, for time and time again he has served on committees, and twice while in high school was a class officer. This year he served as a member of both the Honor Legion and the Student Council. Bobby has been interested in military and this year he won the rank of captain. Entered 1944, 6 years: Corporal l: Sergeant .23 First Sergeant 3: Second Lieutenant 4: First Lieutenant 4: Captain 4: Football 1, Z, 3, 4: Captain Football 4: All MFSL Football 4: Bas- ketball Z, 3, 4: All MPSL Basketball 3: Box- ing 1, Z, 3: Minnesota High School Bantam- weight Boxing Champion 1: Baseball l, Z, 3, 4: Captain Baseball 4: All tournament Intramural Basketball l: Best Athlete Z, 3: Athletic Medal 1, 2, 3, 4: Football Fighting Heart 4: Typing 2, 4: Class President 3, 4: Military Ball Com- mittee 4: J. S. Committee 3: Cadet Council 3. 4: Unit Citation l: Good Conduct Bar 3: Class Scholarship 4: Leadership 3, 4: Color Guard l, 2, 3: Social Committee 2. 3 iEE:E: Le E - .-,-..'--,,:::1:--Y-,-T.r...T---:,--,-, - -I,,,,,,,,,TL,,,,--,,a'..1. i.-e-....n., . -.-.-.-.1-.r 1.- iv.-I - ff'-.f f ra a:rifrA6:: Billy Holberg's list of achievements at Breck is probably longer than Mr. Fox's list of requisitions. Bill has been one of the most colorful and popular cadets in the school, and the class of '50 elected him class president in both his junior and senior years. Billy served on the student council for two years and in his senior year became a member of the Honor Legion. Athletics is where Billyls heart real- ly is, and he, along with his brother Bob, has run up the most impressive sports record ever seen at Breck. Playing every backfield position, Bill spent four years on the varsity football squad, an all-con- ference position was the crowning glory for this mighty mite. Boxing was Billy's favorite sport and his speed, ring poise, and punch made this southpaw a dangerous man in the ring. Only one defeat has blotched his record while in high school. His ball handling finesse made him a Whiz on the basketball floor. When the snow began to melt and spring came around the corner Billy dragged out the base- ball equipment and went out to cover first base for the Mustangs. i' 'A' 'Ir if Entered 1948, 2 years5 ll.F.C. 35 Corporal 41 Crack Platoon 4: Junior Varsity Football 35 Varsity Football 45 Intramural VVrestling Champion 45 Varsity Track 45 Swininiing' 3. - - - a. a. : -. , - .- 1F . -5' l -,5g5,y5-glgyiigga'5'5:.::11a:::.:::1a:a::aziarfizia 1-,-1..-- - '--''- - :-F'-v--fiziiaf-a-: 1 If you ever turn up at school sporting a bad case of the blues there's one fellow who can make you drop them like a ton of bricks. The guy is Dick Holmberg, and the reason is that he is always wear- ing a smile that makes you see things a little bright- er. A happy song is part of his uniform, and he is the nicest guy in the world-until you meet him on the football field. Dick's big six-foot one, 240-pound frame filled up the Mustangs, defensive tackle posi- tion, and when he comes through the line his inten- tions aren't exactly the kindliest. He handles him- t if 'A' 'k self about as daintily as a Marine handles a bull- dozer, a fact which he proved last March when he captured the heavyweight crown in the intramural wrestling tournament. Dick is one of the ablest committee members the senior class has had. He was an important cog in the decorating of the Mili- tary Ball. Dick's real accomplishment, however, is what he gave to the school with his good natured spirit and kind heart-an accomplishment which can only be measured by his many friends who will never forget him. lfl1lk'l'0ll ll!-14, 6 ycarsg Corporal 3, 4: Yarsity liootball 4: Varsity Hockey 35 junior Varsity Basketball Z: junior Hockey l, 23 junior Yar- sity Football 2, 3: Boxing Tournament Champ- ion l, Z, 43 Best Boxer Z, 4: 'l'umbling 1, .25 Intramural Sports l, 2, 3, -lp Horseshow Award 1, Z3 Softball Z: Social Committee l, 2, 3, -1: j-S Committee 43 Good Conduct Medal 33 Class Scholarship 3: F-S Committee Z: XfVoodcraft l, Z3 Unit Citation 2: Typing 2: lk-rfect Attend- ance l: Swimming Z: Head Decoration Com- mittee 33 Decoration Committee 2, 3, 4: Fifti- ciency Medal 43 Homecoming Committee 3, -1. -e:..: - T IZTIHZ1 I . --- .- :: : -. , - 7 -..-,- ... wiiril--zeiliiiiiiislll:l:s.-::9:::.-' As one of the most versatile athletes in the class of ,50 Bill has captured seven IV and varsity letters in three sports, hockey, basketball, and football. He has also had a sparkling record in intramural boxing winning three championships and two 'iBest Boxer awards. He also boxed with the varsity team for a short while. One of his major sports achieve- ments, however, was his outstanding defensive back- field play on the long-to-be-remembered football squad of 1949. I0hns', is well liked by his class- mates and has become famous for his gala open houses and house parties. All those attending agree that when it comes to throwing live parties he rates among the best. Iohnson's favorite sport during the summer besides chasing White Bear women is prac- ticing the art of sailing on White Bear Lake. Bill is very socially minded and attends as nearly as pos- sible every social function of the school. In addition to this he was in charge of the decorating and clean- up committee of the Homecoming festivities and a member of the decorating committee of the Mili- tary Ball. t 'A' 'A' -lr Entered 1940, 10 yearsg Lance Corporal 13 Corporal 25 Sergeant 35 Second Lieutenant 42 Swimming 1, 23 junior Varsity Football 1, 23 ,lunior Varsity Basketball 35 Junior Varsity Golf Z, 3: Varsity Football Manager 43 Varsity Bas- ketball Manager 4g Unit Citation 1: Class Schol- :rship 21 Good Conduct 31 Class President 1. - z. i- 2 5 ' r --,-- F ..w!- 5..-4 1.?:!!:s::.!::.2 -sn!:!g.'::s -rggygg:-5,52-Q-.-.-..f.? Hizl'-7. .. ...-4.45,-,555-vagueJ,-l,,,,,,,,--wash-A-'...,-.U-.:-... 1 - :afar- ffz':z: Whether the question is HHOW can I get this rifle clean Pi' or 'cWhere can 1 Hnd the first aid kit?,', George Lanphear is ready and able to come up with the answer. After spending his junior year as supply sergeant, George was promoted S-4 on the battalion staff, the supply Officer. In this position he was re- sponsible for about 310,000 Worth of military equip- ment. The job entails a maze of records and paper work as well as the physical maintenance of the armory. A room full of greasy rifles greeted George when he reported for duty this fall, and when, early 'k 'A' i' ir in the school year, the government held an ord- nance inspection, Breck was rated highly on the con- dition of the rifles. This typifies the spirit and zeal with which George undertakes any job. As though he were not busy enough, George was co-manager of the football team. In this capacity he found that he was serving the student body better than in the military department, and so, come basketball season, he turned all of his time toward athletics and be- came basketball manager and director of athletic equipment. lintered 1947, 3 years: P.F.C. 35 Corporal 43 Intramural Boxing' 33 Intranlural XYrestling Champion -lg Bugle-Mustang Pliotograpliei' 4: Perfect Attendance lg Class Scholarship 3: Typing 4, I e - 9: V e I - e I e I 5 -- .-a.:iTa-....i-..a!1--!.!:!5:'!:YZ.-1-:-4.!1!-i1:Y!.-'.-: -555:125in::::-s:.eze-ga-.:-:eenzs::'gw:1-::.e:eg'ee:!:'::5' Although Sheldon takes a lor of kidding from his classmates he still remains one of the friendliest cadets in school. His sense of humor keeps the class in fits of laughter, but through it all Shellie still maintains an active interest in his hobbies. Photog- raphy takes up a good deal of his time, and his services have proved an invaluable asset to the De- partment of Iournalism. Sheldon is a participant in almost every one of the sports offered at Breck. In his junior year Shellie was a member of the base- ball teamg however, he deserted the sport in his senior year to take up track. He was used a great deal in the dashes and relays. Sheldon was a mem- ber of the Boxing Club for two years and was a great competitor in the intramural boxing tournaments. In his senior year he took up wrestling during the winter months, and garnered a championship in the intramural wrestling tournament. Throughout his career at Breck, Shellie has always been the type that has proved cooperative and helpful in any possible manner. Committees furnish one of Sheldon's ways of proving helpful. He is always helping the other fellow or the school in such a way that he will be missed in the coming years. 'k i' 'A' i' lintcred l94l, 9 years: Lance Corporal l, 2,2 Corporal 3: Sergeant 45 Staff Sergeant 43 Crack Platoon Z, 45 Bugle and Mustang Pliotogrzpli- cr Z, 3, 43 jun'or Varsity Football 1, 2, 33 Var- sity Football 4g Varsity Hockey l, Z, 3, 43 Cap- tain Hockey 43 All-conference Hockey 43 Var- sity Golf l, Z, 3, 4: Captain Golf 3, 4: Intra- niural Skiing 3, Class Scholarship 25 Unit Ci- tation 3Z Radio Medal 13 Most Improved l' llonicconxing' Committee 4, Good Conduct 2. 1 'i L! ' - I l I s: s -- F555 ,---5--hi-V E- . hi- . I .- -.f . , . --:-. . ::::s-s:.'f 1g -15555:1:fig -Eiiiiiii. -2 -!5EI.'.'j.TiEg 'rEi-iii lim Lilly is interested in many different activi- ties, and is successful in all of them. Iim's main interest is hockey, and after two seasons of varsity play he was elected captain of the pucksters for his senior year. Hockey, however, is not the only sport that lim likes. For four years he has been a main- stay on the golf team, and this year was first man. Iimmy has worked for the department of publica- tions as a photographer for the last three years. Few people know of Iim's love for classical music. It is ir 'A' 'A' 'lr a hobby with him and he loves to expound on the subject. An analysis of Iim would hardly be fair without the mention of his sense of humor. Two Gun, as he is called by his friends, is famous for his dialect stories about Mexico. lim spends his summer months at the tiller of Black Rhythml' on White Bear Lake, where he does well every summer. Needless to say, it will be hard to find anyone who is as capable, dependable, and is as much of an all- around good guy as lim Lilly. Entered 1948, 2 yearsg Teclinical Corporal 33 Technical Sergeant 43 Good Conduct 33 Citation Medal 33 Lounge Award 3: Class Scholarship 3: Battalion Supply Staff 3, 43 Radio Club 35 Glec Club 4. - : 5 . 3 s - 5 5 ... F -,,:5g:.?y,,L!:,,,. -,.-1.-. .f f.-,..1 a..-..'l-- .,, 'llftfii 11:1meIFfiiiiiiiiigigiiilnifiz- ... . The best way of describing Iames Lindls two years at Breck is telling of the many things which he has done for others, but that would involve more space than it is possible to use. Ieb,,' as he is called by the cadets at Breck, spends the better part of the day playing the role of the good Samaritan to the boys of the boarding department. His attitude to- ward his work and friends is carried into the mili- tary department where he serves as a supply ser- geant on Capt. Andahazy's staff. He spent a great deal of his spare time this spring painting the gun room and preparing it for the government inspec- tion. Being an author is one of Iim's ambitions, and he has already turned out one novel in his spare time. Ieb's most unusual hobby, however, is his ability to play the harp, but he is not able to practice much because it is so difficult to find them. In his two years in the boarding department he has taken a great deal of good natured kidding from his mates, but he has also been a friend to all that knew him. 'A' if 'A' 'A' lintered 1945, 5 years: Lance Corporal 35 Cor- poral 35 Squad Sergeant 45 Best Squad 15 Bugle Cartoonist 1, Z, 3, 45 Mustang Art Editor l, 2, 35 Mustang Editor 43 Intramural Boxing Champion 43 Boxing Club 1, 25 Junior Varsity Football 1, 2, 35 Tennis 35 Varsity Tennis 45 Swimming 15 Typing 15 Art 15 Christmas Ball 35 Class Scliolarshin 2: Homeconiing Commit- tee 4. 5 a .. i .. : -. A n!,y,ny5,,,.-gg-,5.f..,...i--,.-.:-... r- Aes:sae:1-1:1- 1. :z-:5EI'g '.f 1f.i:7iii?5iZiE ' Larry Lindsay has, in' the last four years, put in more hours of work on the Mustang than any other person associated with it. For three years he was the lay-out man for the book, and put in innumerable hours of work. In his senior year it looked like Larry was a natural for the editor's job, and as it turned out he was. The 1950 Mustang is one of the best year books ever turned out by Breck School. Larry is also a line artistg however he prefers to draw cartoons. Larry, however, does not spend his whole day in the journalism office. He turned out 'Ir if 'A' i' for the intramural boxing tournament and won the championship of his weight division. Larry also has played many junior varsity sports, and played on the varsity tennis team. Larry's best point however is his sparkling personality. He is famous for his jokes and puns that make people laugh despite their corn. All these different qualtities combined can only be combined in a person like Larry. Like the Mustang, of which he was editor, he will never be forgotten by those at Breck School. lfntered 1948, Z yearsg P.lf.C. 35 Lance Cor- poral 33 Sergeant 45 Glee Club 3, 4: Honor Legion 43 Honor Student 3, 4: Good Conduct Bar 33 Outstanding hlCI11lJL'l' of the Clue Club 35 lSenior Lonccssions Cont-mittee 45 Military Ba l 4. I ii E E1 -.-,-,-.-.-.-....,..T:.-.-.-- .1 5 6 rages..-:::.gs :::::i5lEiEi?j52 Y -.--.- -.-. --.--1-. -f.--1la,-4-5.,-.- Although Dexter has been at Breck only two years, he has entered into many things for his class and the improvement of the school. He served faith- fully at the senior concession stand, which sold can- dy and pop at all home football games. The glee club will miss an able worker and good tenor when Dexter leaves this year, he has been with the glee club the two years he has been at Breck. Scholastic- ally, Dexter has always placed on the honor roll, for he works conscientiously at his studies, as well as at other activities he undertakes. Those who have missed his subtle humor and witty remarks have really missed something. His friends roar at these constantly, and every once in awhile some get out in the classroom, and teachers and boys alike take time out for a good laugh. One of Dexter's interest- ing hobbies is raising tropical fish. He is quite an expert at this, having done it for quite a few years. He has supplied the biology department with some of the fish he has raised. Dexter will be missed by many when he leaves. 'A' 'lr if 'A' l':lltCl'L'Cl 1940,-1 yearsg l'.lf.C. lg Lance Corpo- ral Z: Corporal 3g Sergeant 4g Junior Varsity Hockey lg Varsity Hockey Z, 4: junior Vzxrsity Football Z, 35 junior Yarsity Golf l, Z, 33 Swim- nrng lg Pliotograpliy l, 23 Crafts l, 23 Class Scholarship lg Unit Citation 2, 3: Varsity Letter Awarcl: -Iournalism Award. ' J 5 I F ' - T. H .z--.-.,-.-:. ..-r:z::s:::a:z:1-1a:z::.1iari:.:.:5355555i3,i.:555555551 ''-zzaazziziafiariva-2Aazz:.--Q-A-4-1-A--,..--1--- -. Whether it be cleaning up after a dance or shov- eling the hockey rink you are sure to find Barry McGrath doing more than his share of work. Bar- ry's helpful attitude is only outdone by his cheerful- ness and good humor. Barryis willingness to co-op- erate is proved by the green and White medal he wears on his chest for service above and beyond the call of duty. He received it after assisting in clean- ing the corps rifles when they first arrived. Hockey takes up Barry's Winter months, and this year he won himself a starting position at a defensive post. ir if 'Ir 'A' When he got the position it was a climax of three years of hard Work on both the junior varsity and varsity squads. Photography is another one of Bar- ry's enthusiasms. It started as a hobby with him, but it was soon apparent that he was better than av- erage. He is now one of the most responsible photo- graphers on the Department of Publications staff. Barry's summers are spent at White Bear Lake Where he skippers his sailboat, g'WinWaggin.', He is very successful in this Held as he is a constant win- ner. lintcrcd 1945, 5 years: Corporal 23 Sergeant 3: Second Lieiiteiialit -lg lfirst Lieutenant 4: Foot- lxill Manager 45 Bugle 2, 3, 43 Mustang Z, 3, 43 Baird l, 2, 3, 4: Class Seliolarship 3: Good Con- duct Medal 3g Perfect :Xttenclance 2, 3, 45 Band Award 3, 4. - 1 1 1 r I 2- :-2--2- -. 1 U '2Z E- ! A! ' l'l' -'l i 1 .!:'2-2ilf2'?2f!7'!.- a l.!I'22----v.f.--.5--T2!-a---- c fi5iE5'i 'ri.1'iffiiifnnlllnlitliltl!l?l!l' ?g555H!Hll A1 -1, 15- -ET . . . ll-----l------- - -....-l-..-.v.-.-.-.. Y - -1 For five years the sweet tones of Dick McNary's alto saxophone have wafted over the Breck campus. HMacl' came to Breck in the eighth grade and im- mediately became interested in the musical organi- zations. He played in the swing band in his first year and became a key man in the military band as a freshman. In his final year Dick played first chair for leading saxophonistj. He was commissioned a captain and led the band not only militarily but also musically. Mac,' was also an indispensable member of the department of publications. He served faith- fully as the staff librarian, a thankless task that in- volves hours of time and effort put toward keeping engravings available. His files of Mustang and Bugle cuts were well organized and constantly used. Dick helped the journalism department in another way, too. He furnished the Bugle and Mustang with several photos he had taken as a hobby. In his senior year Macy decided to take on more work that would benefit his school and his classmates. He volunteered for another tough job that carries little recognition-that of football co-manager. i' 'A' 'A' if lintered 1941, 9 years: l'.l .C. lg Corporal 2, 3g St-rggeant 4g First Sergeant 4: Second Lieu- tenant 41 Kilee Club lg Bugle li Crack Platoon 2: Class Scholarship Z3 Good Conduct 31 Cita- tion 33 Senior Refreshment Committee 43 Sup- ply Staff 4: Chapel Attendant 4. r 5 : ...- -, -..-.- .?-.--..--- .-.ng'.e::u::z: -12:21:: -'Az:::2:-:E::5 Y -.-.-,f.v..-..-.-.---a-.-.- - r-v.- --.f.v.1 .--- -. Larry Maetzold's accomplishments range from firearms to cartooning. He collects and fires all types of guns as a hobby, and, in his sophomore year, he was a member of the Breck trapshooting team. Larry and his 12-gauge shotgun are frequent com- petitors in the American Trapshooting Association. He was a member of the battalion staff Qsupplyj, and many of his leisure hours were spent in beauti- fying the armory. Larry has become known as a great Texas booster, for he was born in that state and has made many recent trips there. He is inter- ested in animal husbandry and hopes some day to 'k 'A' 'Ir 'A' be a rancher. In his spare time, Larry likes to play the piano. He uses '6The Moon Shines Bright On Pretty Redwingn as his theme song. Larry's quick sense of humor and amiable personality have bright- ened many a gloomy day, and he possesses a rare ability as an artistg put these two characteristics to- gether and you have a humorous cartoonist. Through his father,s business college and a great deal of hard work, Larry has given himself an edu- cation superior to that of the average high school student. y All lintererl 1949, lyj years: I'.I7.C. 33 Mustang 4g Dramatics 4: Typing 35 Swiinming 3. - - . -. 5 - : I : -' : :: ---5 :-.--.'.---.-...-wil1.5--:Q-114,551-'g::y,,.-5.1155-,gym .' ' Eiiiiii-!EE'E:'guE!EEg.E5:!'!- ..:?:ie-e-:'g?::Queue Broken Nose Alu is a nickname that no longer fits Al Miller. Al's nose, a famous landmark around school, has been rearranged in the way a nose should be through plastic surgery. Al is a summertime resident of St. Thomas, North Dakota, and a winter- time resident of Breck Schoolis boarding depart- ment. At least that has been the arrangement for the two years he has been going to Breck. We seri- ously dpubt if most of the boys at Breck really know Al. From afar he seems rather quiet and mature. Once you get to know him heis what you could call a regular fella. If you get into a conversation with Al you are going to hear stories of the most remarkable relatives you have ever heard. They've done everything from inventing the printing press to starting the second World War. Al loves to hunt and fish. He and Holly Sommers went to Canada and watched their guide shoot their only deer. In regard to college, Al is finding out which school has the highest proportion of girls to boys before he makes any decisions. 'A' if 'A' i' lintered 1943, 7 years: 1'.l .C. 15 Lance Corpor- al 1: Corporal 25 Sergeant 3: Second Lieuten- ant 45 lfirst Lieutenant 45 Captain 45 Crack Platoon Z, 35 Junior Varsity Football 25 Varsity lfootball 3, 45 Honor Student 1, 25 3, 45 Legion of Honor 3, 45 l'resident of Legion of Honor 45 Head of TB. Fund Drive 45 Vice-president of Ski Club 4: Intramural Sportsmanship Boxing Award 25 Class Scholarship 2: Outstanding ei'- fort 3: Citation 1, 25 Perfect Attendance 1, 35 tiood Conduct 1, Z, 35 Spiritual Influence 35 Ef- ficiency 3: Soldierly Cadet 35 Social Committee 25 Military Ball 4: Cadet Board 45 junior Var- sity Hockey 23 Boxing 3: Track 45 Skiing' 45 Soft Ball 15 Tennis 25 35 Radio 15 Typing 2, 3. .: - 2- ' I 5 5 -12: .-,- .--. ' -. -1-1' -F'-- :'::!:i::s-lI::LEE2:.eIEEE5:!2.i5EP:iiE ..a-- - All-around is the best way to describe Iohnis rec- ord at Breck. The school activities in which he ex- cels are scholarship, military, and football. He ranks high in the senior class, having consistently main- tained a place on the honor roll. Iohn has risen steadily in the corps, and has held the rank of Sec- ond Lieutenant in his senior year. His quiet, ef- ficient work on the staff is one of the things that has kept the corps going. Four years on the Big Golds, a year on the Blues, and two years of varsity compe- tition at tackle were Iohnis contributions to Breck 'A' 'A' 'A' ik football teams. He has been a member of the Honor Legion two years and president for one, and he served as chairman of the Christmas Seal drive in his senior year. The variety of his activities for the school gives him the right to be called the Iack-of- all-trades and Master-of most of school activities. In his seven years at Breck Iohn has demonstrated school spirit, leadership, character, and hard work. When Iohn set a goal for himself, he always reached that goal. lintered 1941 9 yearsp l'.F.C. li Corporal 21 Second Lieutenant 43 lfirst Lieutenant 45 Stu- dent Council 4: Military Ball Ct7llll11:ttQC 4: Ci- tation 1, 23 Class Scholarship Z3 j.Y. Football 1, Z, 35 Varsity Football 45 j. V. Basketball 1, Z, 3: Unit Citation lg Typing 23 Intramural Boxing' Champion 4. a. 5. :::..:- : 55 ' T 55- F -..lEi,::----- - iff:-7v'::'iF5F5?7i52:.gr!si5EEi5:::gA'.?..-essex2:22:14 -F2f i-?1fX222i141n21QlAAAAa1ll111311'' - 'v- His defensive play in the Frazee game was better than that of any other Breck tackle I have coachedf, So speaks football coach L. R. Milburn of Bill Plummer's football career at Breck. He added that Bill, a very fast lineman, was a sharp offensive player all year and became good defensive- ly in the latter part of the season. Bill lettered in Iunior varsity football for three years prior to his journey to the varsity eleven. He also Won two IV letters in basketball, and he was a key player in the intramural basketball tournaments during his high school years. An oldtimer at Breck Che entered when he was in the third gradej, Bill steadily climbed in military rank until, in his senior year, he was commissioned a second lieutenant and placed in command of second platoon, B company. Bill was appointed to represent the military department in the Cadet Council, and he served faithfully in that capacity. Few Breck dances went unattended by Bill, and his gift of vivid story-telling made him an asset to every party. He is also quite interested in science. i' 'A' ik 'A' lintcred 1940, 10 yearsg Corporal Z5 Sergeant 33 First Sergeant 4: Activities 25 Perfect Attend- ance Z5 Radio Instructor Z, 35 Good Conduct 35 Citation 35 Head Movie Projectionist 3, 4g Class Scliolarsliip lg Radio Club li l'liotograpliy lg Supply Officer 4: Hand 4: Glee Club 3, 4g Pub- lic Address Engineer 45 Stage lilectrician 3, 4. - 3 4' '. -- 2 g - -- -sl .... ---.-.-, 12----.1z:lfv ---Q--f---u. ggfgdgliggiggggggggll15.9.--fliipiiiififiiirnifi' , -A,, v 'All' AA - .. - ...---..-..-1.--.-.----. -- Chuck is probably the most electrically minded fellow in the senior class. At dances and other events he has had to fix sockets, hook lights, and find faulty fuses. Last fall he Worked many hours fixing the loud speakers for the football games. He is very interested in radio and has also brought many re- cordings to be used at skits or plays. He was an in- valuable help to the senior class and the whole school for all this. Another sidelight of Chuckls is movie projecting. He has run the projector for sev- ir ir 'k 'A' eral years now for almost all the films. Chuck also saw to it that the flag was raised. Last year he helped Work in the lounge and this year he has Worked faithfully in the gunroom. He is a member of the communications club which has put on sev- eral skits during the year. He was also a member of the glee club this year. In military he attained the rank of technical sergeant on the staff in his junior year. Chuck is also a member of the high school band. lfnlered lU-17, 3 years: l'.l .C. Z3 Liorporal 32 Sergeant -l3 Staff Serge: nt 4: Tennis 2, 3: Ya'- sity Tennis 43 Ski Club Z, 33 Newspaper 43 Yearbook 43 Typing 2, 3: Chairnian Senior Cone Cessions Coniniittee 43 Hoineconiing Ceniinittee 43 Military Ball Conunittee 43 lfltleieiicy 31 Good Conduct Medal 33 l ourragg'ere -43 Perfect .XltCIl1l2ilIL'C 3: llonor l.eg'ion -l: Honor Student 2, 3. 4. -- 9 -- 2- 5 2 a --.-5TTZ!.-i-:-i-.-T-'--.-.i!.'E1, ----.-.....7. ... -gr-stag:-:xsrzarsiealiens-eegeaiiryiswsgfgeifsrefiii In Bob Roosen you Find a boy who is always ready and Willing to help and do what he can for those about him. He has been a faithful Worker in the department of journalism as typist, ad seller, and writer for the yearbook. Many a reporter on the Bugle and Mustang will miss Bob's typing of their copy so that they might meet a deadline. Bob has been on several committees this year for dances, and has also been a mainstay on the senior concession stand committee. He has consistently been on the honor roll all his years at Breck and ranks among the first five in the senior class. He has received various rewards during his stay at Breck and has Worked conscientiously at the military as Well as his studies. Athletically, he has taken part in skiing and tennisg this year tennis has been his main interest. Bob has come to the majority of the dances and has taken part in almost every other social gathering the school has had since he came in his sophomore year. i i' -A' ir 'k lintered 1942, 8 years5 1'.lf.C. 15 Lance Corporal 23 Ccrporal 3: Sergeant 45 Staff Sergeant 45 lfirst Sergeant 45 junior Varsity Hockey 31 Varsity Tennis 3, 45 junior Varsity Basketball 25 Honor Student 1, 2, 3, 45 Honor Legion 45 Homecoining Dance Committee 45 Military Ball Coinniittee 45 lntrainural Boxing Chain- pion 3, 45 Chess Club 15 Choir 15 Typing 2, 35 Unit Citation Z5 Best Squad 15 Class Scholar- ship 2: Riding 1, Z5 Activity award 25 Crafts 25 Vyloodshop 1. S- 9 3 5 V. -, . : 1 :':.'::.1nv:!.'zfr:r::c: 1-Fsnirirs vii 1--vw '-v----F----Y -52Z:l:,'A2'!!E25!:'2'i!:!L 2'.!T : ge-LE5iEL7SEEEEi Breck and the Sipersteins seem to just naturally agree with each other. Like his brother Marvin be- fore him, Ierry is one of the popular, colorful char- acters of his class. Scholastically he has maintained a consistent honor roll average. His accomplish- ments in athletics include several years of junior var- sity hockey and a couple of intramural boxing championships. Ierry has also been active in Breck social life, attending most class and school affairs and serving on committees such as the decorations committee for the 1950 Military Ball. What makes ir if 'If i' him liked so Well by the cadets? Perhaps it is his ca- pacity for having fun. Or, maybe it is that he is Willing to give six cadets a ride in a howling bliz- zard, occasionally pulling one of them in from out of the Window While the Studebaker is going thirty miles per hour. And Who can forget the l'Siperstein training schedulen: ride six blocks, get out and push one. This helpfulness and Willingness to do favors seems to be second nature to Ierry. It will be a Warm day in Ianuary when Ierry Siperstein is forgotten at Breck. lintt-red l9-17, 3 years: Corporal 2: Sergeant 31 Second Lieutenant 4: First Lieutenant -lg Bugle 4: Mustang 45 Cliairnian Concessions Connnit- tee 43 Good Conduct Medal 33 Citation 23 Honor Legion 43 Honor Student Z, 3, 4. ' Q 1. 2' .ei -- I' -- . :--.-.-s 5..- e -.::a::i::: -.,,,,,,,,,,-.5ggggggg.-Rmkgggg 'if':iiZ77i . -..-.- -.- - -.- ..,. -.-.- - - . ..- .Au-U.. Hey, Phill Has the mail come yetF,' This is the cry heard every day by Phil Smith, who delivers the mail to the boarders, hungry for news from home. A dormitory wheel in his senior year, Phil has been a model boarding student for three years and, in November of 1948, he was named Boarder of the Month by the Breck Bugle. The boy from Wyoming, Iowa, proved to be a valuable asset to the journalism department as a staff typist. He did a great deal of work on the Bugle and Mustang and he soon learned to capitalize on his ability to type by charging fellow boarders a flat rate for typing themes. Phil's social life has been very active, par- ticularly among the Washburn girls. They just can't resist his friendly smile and quick wit. He maintained a high scholastic average throughout his years at Breck, and he was inducted into the Honor Legion in the spring. Phil reached the rank of lieutenant and headed a platoon, later he became commander of B Company. His hobby is auto- mobiles, with which he became familiar while Work- ing in a filling station. 'A' ir 'lr 'k lintert-tl l94fm, 4 yearsg Lance Corporal l, 23 Corporal 33 Sergeant 43 Second Lieutenant 41 liirst l.icute:nant 43 Junior Varsity Football Z, 31-llllllill' Vziiuaity Hockey, l, 23 Varsity Hockey 3, 43 Varsity Baseball 43 Crafts 13 Typing 43 Bugle Pliotographer 43 Chief Mustang' Pho- tographer 43 Honiecoming Dance Committee 43 Queen Connnittee 43 Social Committee 3, 43 Military Ball 43 Swininiing 2, 33 Crack Platoon Z, 3, 43 Unit Citation 1,23 Class Scholastic lg llonor Student 43 llonor Legion 4. - .e : - i gn up 2 A-' - ----.:T-..i--..z.,.-i..,.!T.:!:!::::'g.e :sas AY-'-- lv --F- -gemeleez .5F:5:5!e:-:'g's::e:'::i :':e:ig5E'7'-i'ii'T T'Ti -- Anyone who knows Nippert Smith will tell you that the proverb, lf it is worth doing, it is worth doing well,', may well be his motto. This industrious fellow enters into all sorts of activities, and does it so enthusiastically that he is soon an expert at the task or an authority on the subject. Skiing is Nip's favorite sport, and he spends all his leisure time on skis. When a vacation rolls along he is off with his friends to the mountains of Colorado or to any other place where he can be on skis twelve hours a day. 'A' ir 'lr 'A' Hockey is second in line in the way of winter sports, and Nip played wing on the Hrst line for the Mus- tangs last winter. Hunting and fishing are more of Nippertis pastimes. His father and he spend weeks at a time on trips in search of good shooting or bountiful trout streams. Photography is a big favorite with Nip, and he is chief photographer for the Department of Publications. Nippy rose to the rank of second lieutenant this year as captain of the rifle team. Enterecl 1942, 8 years: I'.F.C. lg Corporal 2, Sergeant 3, First Sergezmt 4g Hockey Manager 43 Baseball Manager 43 Class Scliolarsliip lg Unit Citation 3. .9 2 T 2 Y 2 I fiiiiiii55ElEEiEiiiiilvfiiiiiii.-JiiiiLTL5525 How big is a hockey rink? Holly Sommers will probably claim that it measures lO miles by 30 miles. And he should know. As manager of the hockey team, hardworking Holly braved the winter winds countless times during the season in order to flood and shovel Breck's arena. Never complaining about the cold for anything else for that matterj, he was the team's most ardent fan and guarded the players faithfully against cuts, Charley horses, and broken sticks. Where most managers would happily welcome a vacation after a busy season, Holly, a glutton for punishment, took his towels and tape with him to nurse the baseball team. He will long be remembered by his classmates as a cordial host. While he is not the originator of the senior stag par- ty, he doubtless made many, many noteworthy im- provements on the requirements for a successful stag. Seldom seen without a smile on his face, Holly has a livewire personality that adds zest to any group. Always full of tales about hunting, laugha- ble, likeable Holly Sommers is sure to be a hit when the Class of 1950 holds its first reunion. 'A' 'A' it 'A' Entered 1945. 5 ycarsg l'.F.C. 13 Corporal Z: Second Lieutenant 45 First Lieutenant 55 Staff Z, 3, -lg Track 43 .Nctivitics Bar 1: Efficiency 1, Z3 Unit Citation Z3 Perfect Attendance 33 Good Conduct 33 Class Scholastic lg Honor Legion 4, z- 5. i:5 5 E - '5':Ii:,---.i-.,......----. -....,1---,..--,:h,..f.-T. :.-......T51L.,,..--in is-2- -aaaiaanb:-1ia1luaff:aas -- Z-4 Zia - i' Spring brings many things-the grass, the flow- ers, longer days, and government inspections. The inspecting officers didnit take Breck's military de- partment by surprise, though, for Lt. Wilbur Tusler, S-1 Cpersonnel officerj of the battalion staff, had kept records that made the visitors' eyes pop. Wil- bur's job is composed entirely of paper Work. He spent hour upon hour revising musty records and setting up a filing system accounting for the govern- mentls pages of correspondence and data. He kept individual records for every cadet in the corps, and the task of correcting, recording, and filing all of 'A' al' ir 'A' the numerous military examinations fell to him. Wilbur posted the training schedules and other in- formation lists on the military bulletin board and Was the man behind the efficiency of the military office. Through it all he remained the same easy- going, friendly Wilbur Tusler who entered Breck in the eighth grade. He was never too busy to join in a congenial conversation and his free-flowing Wit graced many a party and dance. Wilbur's gradua- tion will leave a gap in Captain Andahazy's office that will be hard to fill. ll l Entered 1948, 2 yearsg Lance Corporal 35 Ser- geant 43 Varsity Basketball 4g Varsity Tennis 45 Boxing Club 33 Typing 3: Gymnastics 43 junior- Senior Prom Committee 35 Refreshment Coni- niittee 43 Good Conduct 3. 9 '- --: 5' 'Ez -- yu. -.- '.v.--1- - - ff. .1 -, - . --- -:I'EiE9ii'?ii'giA?'EiiiT-E593Eiiiiii The Duke of Duluth, the Hay Fever Haven's gift to Breck, Richard Walsh. Rich was a boarder dur- ing his two years at Breck except for the week-ends towards the end of his senior year. Everyone often wondered what he did on those week-ends, but all they could get was mumblings about Duluth wo- men and something about all the bears in the woods around Duluth. Always willing to go along with you on an idea he was responsible, by actual count, for the loss of 13 of Mr. Genovese's precious hairs. At the same time he was rather soft-hearted, and when there was a fight Rich was ready to arbitrate and bring the enemies together for peace talks. There was basketball in his senior year. He also jumped to the rank of sergeant in just two short years. Before he started trotting home on the week- ends he was very active in the Week-end social life around school. You'd often think that he was on more dance committees than there were dances. Rich plans on going to the U. of M. Duluth branch with the women and bears. 'Ir it i' ul' Entered 1946, 4 years5 P.lf.C. 15 Lance Cor- poral 15 Corporal 25 Sergeant 35 First Sergeant 35 Second Lieutenant 45 First Lieutenant 45 Captain 45 Varsity Skiing 3, 4: Swimming 1, 25 Golf 1, 2: Rifle, 25 Captain Ski Team 45 Skiing 1, 25 Intramural Skiing Championship Team 35 lntramural Basketball 35 Bugle 2, 35 Mustang 2, 3, 45 Bugle Editor 2, 3, 45 Mustang Business Manager 45 Executive Editor of Publications 45 Treasurer Minnesota High School Press Ass'n. 35 Secretary of Class 25 Vice-President of Class 45 Class Social Committee 2, 3, 45 Chairman So- cial Committee 3, 45 Head Cheerleader 45 Home- coming' Committee 3, 45 Football Queen Com- mittee 3, 45 Chair-man of Homecoming Commit- tee 45 Chairman of Military Ball Committee 45 Chairman of F.S. Committee 25 Chairman of J.S. Committee 35 Christmas Ball Committee 45 Business Manager Magazine Subscription Sales 35 High Salesman, Magazine Subscriptions 3, 42 Cadet Council 3, 45 Treasurer of Cadet Council 35 President of Cadet Council 45 Ski Club 1, Z, 3, 45 Vice-President of Ski Club 35 President of Ski Club 45 Radio Club 15 Unit Citation 25 Good Conduct Medal 35 Soldiers Medal 15 Effi- ciency 15 School Service Medal 35 Best Sergeant 35 Outstanding Boy Award 35 Best Squad 12 Leadership Bar 3, 45 Class Scholastic Award 15 Honor Student 1, 3, 45 Honor Legion 3, 4. 0 ' ' E- E ----.---.1.---rv-.-.-.---..l------,lS-----,-- AInnull:wixiriuuiwrlui-111-111111111greg' 5-5, ' ?Z77i5Z57i? iZ7ii ii9i'i ''SZZZZZFI ' ' ' -Y - e 'W' 1 lt isn't until you have to sit down and write a biography of Sumner's life at Breck in 180 words that you realize just how much he has done for the school. When you go through the Mustang and look through the pages, it really dawns on you that besides being partly responsible for the yearbook itself, he was behind 90 per cent of the activities you see in the pictures and read in the stories along- side the pictures. ln many cases he was responsible for dances, decorations, tickets, and refreshmentsg he worked at concession stands at football games, he if ir 'A' 'A' won the magazine subscription sale drives two years in a row, was Bugle editor, Executive editor, a cap- tain in military. He was a member of the Honor Legion and cadet council chairman. Sumner was a class officer, ski team officer, and an honor stu- dent. Young's last three years at Breck were spent as a boarder. Many were his stories of skiing out West, and who'll forget his open houses? Sumner Young has contributed as much to Breck School as anyone who has ever gone to Breck. ge X? L 'WW T . Class officers, lc-ft to right: Yiccr-l'11-siclc-lit Young, vl,l'l'Slllt'lli XY. llullmn-rg. 'lll'C2lSl1l'C1' liocliii, Scc1'c'ta1'y Hzirllcy. he Elm of 1950 Classes come and classes go-but few can match the record of the class of 1950. Their drive, their spirit, and their high ideals have left an indelible mark on the pattern of life at Breck School. The story of the senior class has many highlights, each shin- ing as brightly as the other. For some, the story begins in the second or third grade, and, for others, it lasts only a year or two. Oldtimers will recall The School Globe and The Sixth Grade News, iournalistic attempts which demonstrated the early ambitions of the class. Fistic abilities came into evidence while the seniors were in the sixth, seventh, and eighth grades. Lock- er room battles between the A and B sections are among the fond memories of many of the class members. Then, in September of 1946, came the big iump into high school and the union of the two factions. The freshmen soon be- came noted for their espirit de corps and, to promote school spirit, they chartered a bus to provide transportation for their fellow cadets to Shattuck and a baskeball game. The Mustangs won by a shade, and much of the credit was given to the large cheering section. This type of spirit has continued until this day, and, as a part- ing gesture, the class of T950 presented the school with a bas- ketball scoreboard. Scholastically, athletically, or socially the class of T950 will be hard to top. Adipex P-e. 3 Q :FF 'Sv .. ... .,.. me-.f . .Q x ,NWLW ie 4 70445 Meg . . . ARENS leaves the upstairs bathroom in a cloud of smoke. ASLAKSON leaves to run the co-ops. BARKER leaves with a wild babble of conversation. BYERLY leaves Mr. lirenz to translate by himself. TOM BODIN leaves his teletypes to THATCHER and IMM. DON CARLSON leaves his tight collar to HAGSTROM. CARTER leaves DIANE to KIRKVVOOD. COTTOR stays - NELSON leaves. CRAVVFORD leaves with faculty chasing. DANKS leaves after years of trying. DART leaves his Minnetonka taxi service to whomever wants it. DVVYER leaves his chin to MALDONADO. ELFSTRAND leaves at midnight for Stillwater. FRISCH leaves new atomic theory to KVIEN. GIBSON leaves on horseback. GOOD forgets to leave-still sleep- ing in class. GREENBERG leaves without being paid for MUSTANG pictures. HARTLEY leaves with candy sales money. HAUGE leaves his charms to RHEE CHANG OO. R. HOLBERG leaves anytime after 9:45. XV. HOLBERG leaves DOC without a fullback. HOLM- BERG leaves his horsemeat sandwiches to the boarders. JOHNSON leaves book, lOl Ways to Skip, to VVilsey. 2044: tie!!! Ze . , . ARENS-Mayor of Dundee. ASLAKSON-+Professional bouncer at open houses. BARKER-Eagle counter for U. S. census taker. BODIN-Journalism instructor at boyls school. BYERLY-Lollypop salesman for Curtiss Candy com- pany. CARLSON-I-Iead toothpick at toothpick concern. CARTER-Swimming instructor at Northrop. COTTOR-VVashington Ave. bum. CRJUVFORD--Efficiency expert. DANKS-Walking advertisement for Phillip Morris. DART-No. l man at a male escort bureau. DVVYER-dProfessional wrestler. ELFSTRAND-Lift bridge operator at Stillwater. FRISCH-Artist for True Comics. GIBSON-Great stage comedian. GOOD-Window demonstrator for King Koil mattress company. GREENBERGN-President of M.I.T. HARTLEY-Olympic figure skating champion. HAUGE-Millionaire playboy. BILL HOLBERG-The one with the Toni. BOB HOLBERG-The one without. HOLMBERG-Demonstrator for garbage disposal com- pany. LANPI-IEAR leaves for the ice box at the HASTY TASTY. LEVINE doesn't understand why he should leave. LILLY leaves his eight ball in HUBBARD'S corner pocket. LIND leaves wishing they had polished his shoes instead. LINDSAY leaves YOUNG'S, feet first. LUFKIN leaves his cottage in Anoka to CARL- SON. MCGRATI-I leaves for the Inland to win a trophy? McNARY leaves journalism cuts in a heap on the floor. MAETZOLD leaves for Texas before finals. MARECK leaves singing, Deutchland Uber Alles. AL MILLER leaves for home in a rowboat. JOHN MILLER leaves to join EDGAR HOOVER. PLUMMER leaves for the third squad to get HERBERT. ROBINSON leaves the gun room to RUBENFELD. ROOSEN leaves to take a post grad at Edina. SIPERSTEIN leaves his boxing trophies to BLANCHARD. NIPPERT SMITH leaves in a coffin fchoked to death by his scarfsj. PHIL SMITH leaves the Washburn women as a retaliation. TUSLER leaves Breck without a beef-trust. WALSH leaves for some entertainment in Superior. YOUNG leaves for Hollywood to make movie, While Thousands Cheer. JOI-l NSON-Inmate at Stillwater. LAN PHEAR-Manager for the Lakers. LEVINE-Trouble shooter for the Duncan Yo-Yo com- pany. LILLY-Sampler for Hamm's Brewery. LINDM-Interviewer for Dr. Kinsey. LUFKIN-Basso profundo in a Wagnerian opera. McGRATH-Seal trainer in Alaska. MCNARY-Leader of a dance band. MAETZOLD-Night watchman in a fish-packing plant. AL MILLER-Plastic surgeon. JOHN MILLER-O.S.S. man. PLUMMER-Lilly's assistant. ROBINSON-Supply officer for Chinese communists. ROOSEN-Babbling idiot. SIPERSTEIN-Inventor of Ziperstein Zippers -- the Zipper with a Zip. N. SMITH-Vice president in his father's office. P. SMITH-Mailman. SOMMERS-Lake Elmo social leader. TUSLER'-98-pound weakling. VVALSH-Bear hunter in Duluth. YOUNG-Glory-grabber in an insane asylum. PITTSBURGH PLATE GLASS SID WOLD MOTOR CO CO. Gloss and Mirrors Put this number in your cur for Every For Night Towing Service 9 Building 5 Decorotive GA- 3333 ond 1031 Puyne Ave. St. Paul ' Automotive To. ,581 Need 459 Jackson Gu. 4811 Hotel Porkwoy rmrrnoor LoSolle ot 15th St. Q TRANSIT AND RESIDENTIAL Best Wishes Groduotes The Bloom Family Compliments of BASTON BARRINGTON CHEVROLET Co. ' LU! Skellet Von 81 Storoge Co. Always on lllllfi-iXlXYZlf'5 liclpfulu Nationwide Moving On Our Own Vans 51.41711 CO! 'NTIIOI 'S' S'lflfl'IfCE 1221 West Lake St. PL. 4444 Ma. 0411 Minneapolis 251 1311111211161 Ave., Mpls. Leo. A. Krumpelman Willis A. Krumpelman Compliments The New York Teo of Company 69-71 East 5th St. Mr. ornol Mrs. WE DELIVER Doren A. Eitsert Locally Owned We roast our coffee daily Phone CEdar 0708 CIW IIKIJIVIH4' Your fl'fU'ZJi17y f,7'0I71ClIlA' After High School Business Training Should Precede All Other Plans .Xttcucl tlic HIIIUCLCTII Aliniimpo- , lis lausim-ss College, wlivru train- ! ing' zuirl lJlZlCt'lllt'llL lmotli exccl. WllL'I'C tuition is low :mil ziclvzmccv im-ut swift. 0 First Attend OLDSMOBILE SALES AND SERVICE The Minneopolis Business College 734 Grand Avenue :X 5L'lc'Ct Still vol .Xccwclitecl lay Natirmzxl Association of :X.C'.S. l EQIIU .lf.1i11 -1.938 for frmxvl Imllvfiu N Xivrzllvzt , liwaizfu at Tmztlz .S'f1'vfz' Compliments of . ll. 4 DEcoRAtns1o COMPANY Pointing Controctors ' Pointing ' Decoroting ' Poiper Honging 285 W. Kellogg Blvd. Ga. l804 NEDDERSON TRANSIT prompt and reliable service O 3355 James Ave. N. Minneapolis 12, Minn. Ch. 1469 The Music Box Formerly The Record Shop Our new location-Next door to the Old Drugstore in Wayzata The Best in Recordings and , Personalized Service Way. 223 Woyzotcr Pharmacy, Inc. The Old Drug Store Dependable Prescription Service Largest Photographic Department in the lake Area Wayzata, Minnesota Wayzata 53 or Wayzata 31 let the DAVIS TRAVEL AGENCY PLAN YOUR VACATION TRIP Unis srsr or service' w. in National Bank Bldg. Lobby ce. 1856 sf. Paul Zine Beal of ucfc Qzacluaiea The Sands Family Gzacle 8 Glad 4 l lI ? The Best Home Freezer isA MARQUETTE FREEZER Be Able to Store All Types of Frozen Foods and Your Own Frozen Vegetables RGY HAWKINSON 4306 Upton Ave. So. WHittier 1858 RED cmd WHITE Food Stores Students Notice NATIONAL CAMERA EXCHANGE Cameras Lenses 9 Bought Binoculars 9 Sold Field Glasses 9 Rented Telescopes 9 Exchanged Microscopes 86 S. 6th St. ATlantic l3ll Minneapolis Need o New Fur Coot? SEE Peterson Furs Co. 57 So. 9th St. Br. 8241 Personalized Service 9 Cleaning 9 Repairing 9 Glazing Exquisite Furs Ready to Wear Compliments From MRS. MERICE P. JENSEN Compliments of COORD ROOSEN lnsuronce Counselor Compliments of Mr. ond Mrs. L. D. Goston NYC 'll-lcgraph Flowers Anywllerc mos LYNES soNs Florists Bn. 6701-2 zofi fri 1' x ini 14 xi Best Wishes From THE SPIZMAN FRUIT COMPANY if ,111 ' 1 X 1 ' S :X If 4- I KX ld , L 1k, X Q I fs ,X 1 Z '5 A ' ifiwi' e Ag-QQ -' n f U 4 ' ' 890: .' ' 4 15171, wg, f 1 s, if. : X- 'Yi fl A nfs 25 1 r 5 t fi ef :fav 0 G - ME AL: .5ll.,l l.,5ll.' GRE Q A IIaha.l!:aImazzauullll r She's always popular because she's lovely and 7 Z vivacifotus. :neil lghcgfms becaluse she takes g00d Illlllllllllllllllllllllm E M careo er ea t . edrin saquart offamed- 3.5Zf8,F. for-purity Clover Leaf milk daily. Its extra P.5TEU .m goodness will help you, too! HOMOGENIZED - Try the new, square, space-saving bottle, MILK , double-sealed for your added protection! De- f7wff0M1fG1ffffffffff livered direct to your home or at your food - V F0 '0U5farPuyjfy store in the new glass bottle or in the sanitary Eli' lE5ic'Wf 'NN ' 'A carton. l 3 X-M Of Course It's GRADE W N W XRS X wt- sror L OUR Dllvll Ol CALL cl'-3391 Q Wie?-T? The Best ot Everything to the CLASS OF 1950 R. C. Hitchcock 81 Sons, Inc. Best Wishes to oll The Breck Students . The Lichthordt Fomily Good Luck to the CLASS OF 1950 Mr. oncl Mrs. Albert J. Jomes The Support Of on Breck Dod Compliments ot the Die Croft Compolny Q Robert E. Giles Mutual Benetit Health and Accident I . nsumnce Compliments O Mutual ot Omaha of lhe Charles R. Kate, State Manager , Beech Family 420 Plymouth Building Minneapolis At. 2579 Wherever you live or work in Minneapolis, you'Il find good banking service and a friendly welcome at the nearest BANK ot the FIRST Group Graduates and Students Open a convenient checking account at one ot your Neighborhood Banks of the FIRST NATIONAL BANK GROUP FOR SUMMER FUN IT'S DISTINCTIVE famp Aquila for Boys Sior Lake Peninsula Denf, Minnesota L. R. Mllburn, Managmg Dlrector 4646 Garfleld Ave. So. Minneapoli 9 Regent 5069 F G Typical of the farms approved by the American Guernsey , Breeders' Asyn, to produce Golden Guernsey Milk is beauti- ful Clues-Mar farm, located near Excelsior, Minnesota, pic- ft Q tured above. Golden Guernsey, available only in sterile glass L quart bottles, is distributed exclusively by Ewald Brothers 5 A in Minneapolis and its suburbs. Insist on the best-Ewald Brothers Golden Guernsey, World's Finest Milk. I Mmugl Q 'Wo , it mS:,flUswu5 , ? inl ':' ' 7.9 E py ccuccucucuuuuuuuuuuau as yyc cccc c,ccucc u , CHERRY 3601 Q FOR DELIVERY DIRECT TO YOUR HOME South St. Poul To the Best of Yearbooks THE DAll'Y REPORTER We give our Support An Independent Newspaper Locally Owned The Sophomore Party Dakota County's Only Daily Newspaper Committee with 58 years of service . . . Al ' ' ' Olaf Best Wishes . . . Hub . . . Hog From ci . . . Pete Breck Stuclent's Fomily coMPuMENts or Ctto cmd Frieclci BREMER Compliments of Mr. oncl Mrs. Wolter Bechik oncl Lonny Compliments of Rt. Rev. Stephen E. Keeler Bishop ot Minnesoto Compliments of Modsen Construction Compony C 2ll0 Nicollet Ave. Mpls., Minn. I NATIONAL MOWER C0- 839 Cromwell Ava. - St. Paul 4, Mlnn. Write lor folder. 33,2 ' Gil! ff sri.. Quality mower builders lor 29 ears. 33 Sickle cuts grass. hay. weeds. I powerful sturdy mower with long proven record. Lots ol traction, easy to handle. two clutches, lull Hneumatic tires. Used lor many hears by ailroads, U.S. Govemment, State ighways. Farmers, Estates. etc. Kenneth D. Hacking, President Congratulations I ,O ,he Kenneth D. Hacking Breck Students GENERAL INSURANCE Andahazy-Adrianova ' FIRE School of Ballet Q AUTOMOBILE ' CASUALTY i680 Grand Ave. Q Midway 1416 Q BONDS A School in the Classic Tradition Telephone Atlantic gf the Bullet Ruggg Building Minneapolis, Minn. Compliments of Westlundis Market House o Freezer Service 0 I Meats, Poultry . Dairy Products I Frozen Foods 579 Snelling No. Corner of Thomas I Phone NEstor 8621 I There's a MATERIAL Difference llgmpland llymber lpompanq 419 E. 8th St., Corner of Lafayette Road Saint Paul CE. 8531 NE. 5030 Celebrating over 53 years on the University Campus Buy With Confidence Wm. Simms Hardware Bring Some Measure of Joy to the Hungry People of Europe Send them the new big CARE FOOD PACKAGE Non-Profit-Government Approved For 510, CARE will deliver o 225 pound package to the Person you name Order one today from CARE The Mayor's Office City Hall-Room l27-Ma. 5398 alll llllh Ave' Si' Sponsored in the interest of better human GL' mal relations by Mr. and Mrs. L. H. Frisch Goodbye ond Best Wishes From Holly, the Loke Elmo Kid lTHlS SPACE PAID FORl Greetings to BRECK STUDENTS ELLERBE AND COMPANY John N. Nelson Deputy State Treasurer State of Minnesota Architects and Engineers Compliments of Modelcrott Distributors, lnc. Wholesale Distribution of 505 First National Bank Bldg. St. Paul l, Minnesota Q Construction Kits Q Complete line of Handicraft 103 E. Kellogg Blvd., St. Paul GA. 8112 MI. 3026 Greetings . . . MGNTANA BIDS You W E L C 0 Flon To Visit This Greot Scenic Wonderland Trovel Highway No. 2 or Greot Northern R. R. See the Great Tour Glacier National Fort Peck Dam Park and Flathead Lake Area ' I-IAVRE DAILY NEWS HAVRE, MONTANA CAMPUS JEWELERS Watches Diamonds Silverware 1310 lfmrrllz Sf. N. E. L7A'f'i7lllCCl-f70Ii.V Glcrrlstomr 5121 MEDICAL ARTS BARBER SHOP .ifr'rI1'z'aI --Iris .'17'CGdl', Nrkollcf af 9!71. ISR, 5824. Hfziwrrtfirzg for men, worrrm and clrildrcrz. Jlarzicrrzfirzg, S1106 slziizirzg. SWANSONKS CAMERA SALES and SERVICE Cfrrrficlfl 6268 321 Sf. Pain' Silva! St. Paul, Minnesota lfvurytlriirg for the :imziieur 1Ji1OlUgl'2lPiiL'1' Qaacf fuck, Senicvui FROM Ma. am! Mu. JI. B. fqalakian Compliments of Mr. cmd Mrs. M. R. Deveney Qaocf fuck, Seniafu GOPHER CAFE UIMMY DEMOSI 9th ond Hennepin Minneapolis To The Compliments of Finest School CUSHING 8g DRISCOLL, Incorporated ' mucus ASSOCIATED ACTIVITIES, INC TO THE JOURNALISM DEPARTMENT AND I BRECK SCHGOL I Ma. ard MM. Sumnefz. B. Waning, I - A Friend Uf I I I I Breck School HENNEPIN TRANSIT 23 N.E. 4TH ST. AT. 5255 - To Ihe Class of I 9 5 O wifh Congrofulafions PHILLIPS COUNTY NEWS ETTEI. and FRANZ Roofing cmd Sheet Metol Controctors f I 2265 Wobosh St. Poul, 4 DAI 9826 Op 7 . 2 p Sundays-9 u.m. to 8 p Walter Meyer SQUEEZE INN CAFE JUST GOOD FOOD Expert Sanding 8. Refinishing 748 G d A Varnish or Wax St P I 5 M Satisfaction Guaranteed Greetings 1-9 the Closs of 1950 'A' from 1007 Von Buren Ave. Mr. ond Mrs. Dole 4761 E. F. Converse Best Wishes i Compliments of NORTHLAND A. G. Johnson MILK Electrotype Compony CQMPANY MINNEAPOLIS Compliments of LCJUIS F. DOW COMPANY GOODWILL ADVERTISING f All . II CW Qt New and Used 61111 gwltgd' . . 0-CQIIGI Unlverslfy X TexI Books For University of Minnesota Greetings Fall Quarter 1950 Classes Come in Freshman Week Esc our z'011z'0a1icJ1i lay-by Nan From A Remember ge? your Books Early BRECK DAD at PERINE'S i fl U I'11iz'c1'.fif5' of iIli1111f'.v i 1-111 L 'crsity Ave. 5.12. F1 ISSJ YOU ARE ALWAYS WELCOME IN MONTANA WHEN VISITING GLACIER NATIONAL PARK STOP IN KALISPELL AND SEE THESE FINE MODERN THEATRES LIBERTY THEATRE STRAND THEATRE 700 Seats 700 Seats ROXY THEATRE SUNDOWN 500 Seats Drive-In-Theatre H A G A Photography Photogrophers of Portroits ond Condicls Gordon Haga Clair Peterson 905 S. llth St. Br. 3798 Clement F. Sculley Equipment Compony HUmboldt 1391-1392 725 Front Ave. St. Paul Compliments of The Lutkin Fomily Compliments of Getchell Steel Treoting Compony Minneapolis Compliments of GROSS BROTHERS AND KRONICKS your Breck School Lounderers ond Cleoners 111 l I NAPOLEONS CAFE THE ploice to eot 1355 University Ave. St. Paul The Best Wishes ot Mr. ond Mrs. C. F. Sommerfield Qlwglmli Furniture of Quality H. S. Cleveland Co. 1018 Nicollet AT. 8228 Minneapolis Congrortulotions From MCGRATH-ST. PAUL CO. Compliments of H. E. Andersen Northwest Service Station Equipment Co. C MA. 5539 Minneapolis, Minn. K E Y so,ooo The Women's Board of Breck School Inc. Sponsors of the Dr. Charles Edgar Haupi Scholarships THANK YOU MUSTANG STAFF l For A Wonderful Yearbook '4It's the Best A FRIEND Compliments of Eric and Winston SANDEEN i- Compliments of Compliments MH-TONS To The Closs , of T950 Dresses, Suits, Cooits onol Sportsweor From O Mr. ond Mrs. C. I. Miller 7 South 7th Street Minneapolis With the Compliments of the ST. PAUL HOSPITAL AND CASUALTY COMPANY MARTIN H. IMM, President 347 Robert Street St. Paul I, Minnesota LEE HOPKINS Service Station Lubrication - Accessories - Lee Tires Motor Tuning -- Batteries and Service Phone Nestor 9036 Como 8: Doswell St. Paul 8, Minn. BETTY'S CONFECTIONERY 1321 Forest St. Paul, Minn. Tower 9102 Dick McNary, Manager Scheffer ond Rossum Co. Manufacturers of LEATHER and CANVAS GOODS St. Paul, Minn. Ga. 7521 E. F. Cottor, General Manager eza azzzzz. ,.1t a iel .. titliii 2f': X fa ' S ttt ' 'n t .,t.,. :.,.,.::,...: Zlz v G9 at tn ? ,,,,V,Z:Z:Z:Z:Z:Z:::::::::::::::::Y:,:-,- : : : E , -Q '-: Q- ,......... - X i 1 Zqq Xi The average family today gets twlce as much electric :ty for its money as It did twenty years ago ?4J4AiZau73' Your nucmcu ssnvmt onmtnu sims Powtn LOMPANY The widest selection Qf the most fkzmous young men's clothes IN THE FINEST DEPARTMENT Suits 535 to 559.50 Topcouts 539.50 to 555 Sport Coats 522.50 to 535 Slucks 510.95 to 517.95 Jackets 53.99 to 518.50 , 35 and a complelev line of boyz' fuinblzings CAMPUS SHOP mum nook ' ' MAURICE L ROTHSCHILD SL C0 Robert an 7th vi 5' Class Rings Pins Medals cmd Trophies HERFF-JONES COMPANY Official Jewelers for Breck School Alumni may order the new official Breck School Ring adopted this year. Please contact Chas. P. Leeds, Company Representative, for prices and procedure for ordering. Representative CHAS. P. LEEDS Phone Pleasant 5939 P.0. Box 867, Minneapolis, Minn. Grace Lee Products, Inc. Jfalzirfactzrrcrx of North Slcll' Soaps, Cleansers, Waxes, Army and Navy Chemicals Store 1414-20 Marshall St. NE. ATla11tic 7129 HINNEQXPOLIS MlNNl2SO'lIX 3ll-l3-l5-l7 Hennepin Ave. Do You Want , MAm 3665 Less Tooth Decay? T110 N0z'tlm'cst's Lmdiizg and f,avfgc.s'zf then Eliminate all Sugar A,,,,,y amy yywy 510,-C Fmm your Diet' Complete Line of Military Apparel for Chzrzfvlirrirlzfs Of al .lflJ1lIt'tlf70llS llmzlixf Officers and Enlisted men C,o111jvI1111c11fs of COIIIftlfllliL'l1f.S' of DURGIN AND SON The Soderlind Fomily Roofing J. L. SHIELY CO. Colllfvlizllcllzis' of A Limestone Veneer for Mr Blair Simon Residences, Churches, etc. J. L SHIELY CO Simon ond Mogilner DEPT-A 1101 SNICLLING AVE. ST. PAUL 4 34 YEARS OF RELIABLE SERVICE Acme Wfhdow fleamhg Serwke 1228 Chestnut Avenue Minneapolis, Minnesoto C. T. Uinkst Holberg, President COMPLIME NTS OF A FRIEND 'lr - - Thonk you, friend. We oppreciote your compliments of or friend od. The Stuff is grofeful for your polrronoge. NATICDNAL BRANDS L In -MiIIWork-Wall Board-R f' g C t-Pwint-BuiIdcr's Hfnrdw COMPLETE PLAN SERVICE FREE ESTIMATES TIME PAYMENTS Whcrc your - - - CASH BUYS MOST UI CII MCDONALD LUMBER Co. NEW BRIGHTON, MINN. NE. 7345 Cpen Saturday Til Noon Complimenfs From P. D. Robinson 65 YEARS or sfkvicf Wei'rzeI's Cleoners ond Dyers Tllc House of IIIIIIIUCIIIUZIC Cluulzizzg I I I I Hennepin lI.'Xin 6659 Weld ond Sons .7v7u4'lw'.v since 1854 S17 Nicollet -Xvcnuc BI inuuzipolis LARGEST BUICK DEALERS IN THE NORTHWEST Clvf U lJFIIl0II.Yfl'6If07' from Il Try il yozlzzwlf. W. R. STEPHENS CO. lfllfz and f'ftU'III0llf ill.-I, 2511 Af1'111lCc1jwIi.s' ST. PAUL BUICK CO. 7lfl film' .UEIIPIQTI CLI, 56'-15 SI. Paul Best Wishes To The Foculfy ond Sfuclenls Compliments of A FRIEND Compliments of Mr. oncl Mrs. Stuort F. Seidl HIGHEST QUALITY FUELS Complete Service Cool - Coke - Briquets N. H. Fuel Oils North Western-Honno Fuel Compony 28 East Sixth Street ST. PAUL - GArfield 3712 516 Second Ave. So. MINNEAPOLIS - MAin 7211 Country Club Nl XSTICR 'l'A1I.ORS :incl L'I.lE-XNliRS -140-1 lfrzlliu- . Xu-. U cur l.. Si1'2lVL'll X Sun VVA. 5-132 Borry Ashwell, lnc. 52 liiglitll St. at First .'Xx'c. No. -1 .Yvw Store Sfnwirllisillg in S'l'INL lSIYli FLOOR COYICRING lJ1iCUIQ.XTIX'li 1JR.vX1?,IiRY .XN IJ UI'1lUI.S'l'1ERY FKIBIQICS ll! 11112 lfL'RXlF-HIXKIS ACCESS! JRIES You will Iilrv our jvm'.m11r1Ii:r'd l70mrufor .S'1'r7Jic'v Best Wishes From Mr. ond Mrs. Rolph E. Williomson Eesti' 2054491 FROM THE AHERN FAMILY . ff if '.,f41 AL 'a ,gg gr e, r 41 I j I ' rr Yr A IK---'5 Fe . . . .. ' I Today's Leaders Drink WIELLO IV' :unitary li Laborator Tested Milk BEHIND EACH BOTTLE of Sanitary Farm Dairies Milk delivered to your door stands the tireless work of the trained bacteriologist who devotes his entire time to the important task of safeguarding the most important item of your family's diet. SANITARY FARM DAIRIES maintain their own laboratory within an ultra-modern plant. In this spot- less, white-tiled laboratory watchfulness, research and constant testing throughout the day insure the purity and goodness of the milk you give your family. It is equipped with the most modern and efficient apparatus for milk research and analysis. Hour after hour tests are made of each day's milk supply, from the moment it arrives in Sanitary Farm Dairies' air-conditioned receiv- ing room until it is sent to your home. 17 x - M 1 ' I . is I f , 1 I ' Q X ff X FABIWI DAIRIES x j fx IFEX! 'fl Fon SERVICE CALL GA. 4991 P -Q OR ASK FOR SANITARY MILK AT YOUR GROCERS Sui Guertin Pharmacy PRESCRIPTION DRUGGISTS BRIDGEMAN ICE CREAM 2264 CUIHO EXW., at Carta-1' St. Paul 8, MIQIIIIICSUIZL Ch rist's Church Episcopal .-IU 'IL'c'll'0lllC to lflc' fff'i.Vc'0fvcI1 C'l1111'c'f1 lJfm'1itmv1i 1-I9 VLEASAXXT AYI2. lilily Scrvicc--8 :OO zmcl ll :OO A.M' ENTERTAIN with ease and distinction Assisted by I Ramaley Catering Co For Over 60 Years COMPLETE SERVICE FOR ANY CATERING PROBLEM Compliments of Bechik Products, Inc. 650 Iizrcvfis Street I QT. EIFJXUI, XV--I, IXIINNIZSOTA World's largest manufacturers of Mattress handles Compliments of E. W. Eltstrand and Family Why do people cooperate? We hear too much nowadays about competition and not enough about cooperation Competition is a good thing, or it may be a bad thing. lt all depends on the end result. There is com- petition in a poker game, but what good does it do the loser? On the other hand, the competition in school ath- letics is a good thing. lt makes for good sportsmanship. But, in school athletics, as in most other activities in which groups of people take part, it's the team spirit that counts most. Another word for team spirit is cooperation -one for all and all for one. That is what makes for the most satisfaction in all our group activities. People learned to cooperate the hard way. Way back, in the stone age, when people lived in caves, they began to realize that they must cooperate or be killed by their enemies. They began to group themselves together in villages. They began to organ- ize their talents so that, collectively, these talents could be used for the common good. Right down through history people have learned that cooperation is a prime necessity. A group of une employed weavers set up a cooperative store in Roch- dale, England, more than T00 years ago. They did this because it was only by pooling their resources that they could get food and clothing. They found it was a good way to do business, so they stuck at it. Others did the same. Now there are thousands and thousands of co-op businesses all over the world. Farmers are among the world's best cooperators. They do many things together. You have heard of barn-raising bees. All the farm- ers get together and build their neighbor's barn. They harvest together. And they build their co-ops together. They build elevator co-ops to market their grain. They build creamery co-ops to market their milk and cream. They build supply co-ops to provide their machinery and supplies. They do all this because they must. lf they didn't build and use co-ops they would have to buy their supplies at retail and market their products at wholesale, which is bad business for anybody. lf farmers didn't cooperate with each other, they couldn't compete with the big factory type farms. ln- dividual farmers would lose their ownership of the land. That would be bad for everyone, because competition would replace cooperation and eventually would de- stroy the fertility of the soil-lust like competition has depleted our forests and other natural resources. People do their best when they work with other people for the common good. That is what farmers have found right here in our own Northwest. That is why nearly 200,000 farm fam- ilies work cooperatively in their FARMERS UNl0N GRAIN TERMINAL ASSOClATl0N Largest cooperative grain marketing organization in America General offices-St. Paul, Minnesota CAMP BRAEMAR for 45 boys 7-14 years Not affiliated with any private school or other organization. First period-June 21 to July 18 Second period-July 19 to Aug. 15 ON LONG LAKE PARK RAPIDS, MINN. Telephone - Hubbard 4F3 All inclusive fee Riding, Sailing, Rifling, Canoeing, Boating, Swimming, Camping, etc. Completely modern with electric lights, running water and toilet in each cabin. Proprietor and Managing Director: PHILIPPE C. VERBRUGGHEN 2284 Commonwealth Ave., C A P I T O L Awning and Shade Company, Inc. Creative designers of Canvas ' AWNINGS 9 WINDOW Shades 9 VENETIAN Blinds ' CANVAS Products St. Paul 8, Minn. Tel- Mi. 2553 ' ORNAMENTAL Iron Camp Director: ROBERT A. SCHANKE 1196 St. Paul Ave., , St. Paul 5, Minn. L. M. Lilly, Jr. Garfield 5439 Tel. Em. 9336 376 E. Eighth St. St. Paul BRECK Founded SCHCCL 1 8 8 6 Devoted to providing education for college and for life, and to pre- paring the youth of all creeds in the fundamental concepts of knowledge, truth, humility and honor. MORISON BRIGHAM, Headmaster 2477 Como Ave. W. Nestor 4516 St. Paul, Minn. '-f, 1 2 'A 1' i ffz. :.iz .' 7. i'.1 f?f'ff5f 3 12 i :i': ' 'i ' iizl er r Clothiers VVESSNER Tailors I 59' i .4 Q t3 S Q 1 A . : W 3 To the Seniors To the Dads Breck School Breck Students We wish to extend our best wishes, and now that you have completed your classes at Breck we hope you keep us in mind for your clothing needs in the future. GOOD LUCK! t : f::2.e5aaiifi2. 11 , ,, f A i I f wg ff , I Z gf ,. ga 5 G? 4 X + 2 , , 2 ff 3 f Z 2 4 , 5 9 5, 3: , W X 5 1 t r . , 2, Ri 55 fa 551-144.--1 -1 :-1-2-1.2: N , we it fg 1 M .s A 'k N S 7 -7 4 .f ' x 4 4 23 2 .-5 Q 3 , .MW ' I s Rf' x S3 M cs a go . 5 , 2, ,, Z 5 .. V , , is ra , CLOTHIERS TAI ORS 15 We wish to take this means of asking you, also, to keep us in mind for your future clothing needs. We carry a complete line of Ready-to-Wear as well as Custom Tailored Clothes. Formerly the Minneapolis Tailoring Company 7 South Sixth Street, Minneapolis Main 0429 P C0H1jvIi111v111'.s' of ST. PAUL NASH MOT0 RS JS-if TV. Collfgv --'lun AHL, MINN. GA C'0111fI1'111c1zz's of UPTOWN BOWLING CENTER 3033 IIK'lIIICf3f71' AWP. AIINNI'::XI,fN.IS RF. 9233 ROGERS JIZXYELIER S 1301 416 Vhlvaslua sf. St. Paul 2, Ninn. Clfclzu' 6767 Compliments From the Sohlberg Fomily Best XVisl1cs From MR. AND MRS. A. V. JUNKIN ci What Do You Know About Life Insurance? Chances are you've already learned something about lite insurance- in school, from advertisements, or from your parents. But we'd like to suggest that you read an interesting booklet prepared by the Institute of Life Insurance, entitled The Story ot Lite Insurance. This booklet will give you a good picture ot the meaning and uses of life insurance--facts and ideas you'll find helpful later on, when you're on your own. lt you'd like to have a tree copy of The Story of Life Insurance, simply write to North American Lite 8. Casualty Company, T750 Hennepin Avenue, Minneapolis S. P. S. You're invited to come and see us in our new building. - md ND, President Founded T896 This space was paid for by all the Cadets of Breck School with the funds raised by the Student Council. lt was bought in the interest of a better Mustang. THE STUDENT COUNCIL Working for a better Breck SO LONG SENIORS, WE'VE ENJOYED KNOWING YOU! WE HOPE WE'LL MEET AGAIN. awww Gam! fuck swim Moy you corry on the sfondords of the Honor Legion in lofer life THE BRECK HONOR LEGION THE BEST OF WISHES TO THE SENIOR CLASS OF T950 THE FRESHMAN CLASS KThe Class of T953?T 1 1 l - i HERE is OUR TEN CENTS WORTH: There are Three Seniors who 'rhink that they are leaving a swell bunch of Joes. DAN FRISCH CHUCK HARTLEY SUMNER YOUNG I I l l Thanks to All who Helped this year ONLY 507, of the mothers paid dues this year. Let us make next year a bigger and better year for the mothers club by paying 1002 dues. I Congratulations to The ' Class of 1950 I ' THE ' MOTHERS ' CLUB QM mtl gcmzilwrltrlf gg Quality M0 HMV J2i:23tiOt:i,fszQ1i22Z, J' homecare between shampoos ,W g 4 f Q: A i. L r A V r j was V A ' in V r Q W ix 'L'+?62'F,g+,,,g15,L,'a X THE 1 OF HAlR CREME5 G f W 'Ll , hm , 9:9 5 . .V, i J, W 'i. if L?5?9f5l+C4B , ,f .'f. if l ,ell Aklgsfffgfj ' i s- or it it 1 U Qt it RQ f Mmm ,QQ V 1 X x .,,,, K wofmwu 600 flllaogtfnalwzawmiti f l I Alllf00VYlf 51742 wigfyxvwl ....af!rZMf!wtitTFwtl'ow aw! aoowcafcfwmrw JVO'?f!lfC0!LMQ, l Congrofulotions From The MCGRATH-ST. PAUL CO In St. Paul It's Glasses by OKTHUR lf WILLIAMS ThoOpticdl Shop 366 St. Peter St. Li i r ' Kahne HECTRIC CO., INC. Contracting Engineers 722 Raymond Avenue ST. PAUL W4, MINN. Industrial Wiring Commercial Installations Power Plant Construction Electric Motor Rewinding and Repairs 1 GOOD LUCK to the Better Class of '50 From the best Class ot '52 Sophomores ESTABLISHED 1910 . 551,11 , lg 1' L in- EJ 1' 3.1.3 ffl..-1-.-Lv 5955: :s 'z: s: f: ::s :s :2 :252s ?f515Wi s:.:-:-:-:-:5:w- Ffzflq --I CA EDEN INSUTQANCEAQENCY Fire - Murine - Surety LHe-Acddenf Cosuohy 1230 Rand Tower Telephone Mpls. Z, Minn. Llncoln 3811 -- -A EVERYBODY ADMIRES A CHAMPION When you choose a Fuel You'll want the best . . . One that's easy to regulate That's economical and easy to start, Gives lots of heat And few ashes .... THE CHAMPION Thofs S TU TT nnlaufrs 0110 of zlllwricrzh' Fiizcxf I?U5'fCIl!I'l17ZfS RAINBCW CAFE lfslalmlislicrl 1919 l6f't'0Il1lIIt'IIl1Ct1 by IDIHIFUII Hill-Us Banquet Rooms for Private Parties HVL'l1l1L'l71l1 at 1.:tkt- Pleasant 4455 A E N D For Better Haircuts Oscar's Barber Shop 1302 -ltli St. SE. Harvard Barber Shop 604 hYZlSl111lgiOll :Xvu 5.12. Foshay Tower Barber Shop Fosliay 'lower by the lflevators Oscar Moln. Prop. ,llu111'C11ri11g lir. 4311 You ought to thank God if, regardless of your years, you are young enough in spirit to dream dreams and see visions-dreams and visions about a greater and finer America that is to beg if you are young enough in spirit to believe that poverty can be greatly lessened, that the disgrace of involuntary un- employment can be wiped out, that class hatreds can be done away with, that peace at home and abroad can be maintained, and that one day a generation may possess this land, blessed beyond anything we know, with those spiritual things-material and spiritual-that make man's life abundant. If that is the fashion of your dreaming, then I say: Hold fast to your dream. America needs it! -Franklin Delano Roosevelt April 15, 1936. A FRIEND Say if wills qloweu Congratulations to the from SCHLETTY FLORISTS MUSTANG Flowers for Mrs. Henry Norman Any Occasion Kaldahl 2525 Edgerton St. Va. 1616 St. Paul Compliments of Hagstrom Construction Co. 1567 Selby Ave. Ne. 7173 ST. PAUL Compliments MUTUAL INSURANCE Of COMPANY The Insurance Service Since 1897 Sohlberg Fomily 2267 coMo AVE. ST. PAUL NE. 9687 Entertain with Ease and Distinction Assisted by MILLER PHARMACY fDependable Servicej The place for an after school snack NE. 3274 2309 Como Ave. West St. Poul Romoley Cotering Co. For Over 60 Years Complete service for any catering problem Compliments of KLEIN'S SUPER MARKETS PIONEER GLOBE PRINTERS 420--I22 Su. 6th St., Minneapolis I'I1u11t- MJXIH 8856 PRINTERS - PUBLISHERS Iixfallrlislzcd 1901 .-X L.UlII1TlL'lC Newspaper, Nlzmgaziue and Cmnlncrcizil I'1'inti11g IESUIIJIISIIIIICIII Ifrznn 'I'ypt-setting to Mailing Rotary Presses for Newspaper Printing O Best Wishes From EVERS AND PILS, INC Minneapolis, Minn. O Mc1ImsIedI's ,I Ltzlwl llzaf Sfwlls C'!ltl7'tICfl'V IVINIQ HATS .NND FURNISHINGS mn MEN MALMSTEDT5 III South St-vt-11111 Strut-t -- Millncnpolis BEST WISHES TO THE CLASS OF 1950 Mr. ond Mrs. I. H. Dorf The Flour City Ornomentol Iron Co. Aluma Craft Aluminum Boats Memorial Tablets .......-.-. Dr. 5471 2637 27tI1 Ave. South Minneapolis 6, Minnesota Compliments of Hermes Floral Co. C0mPHmenBff NWLmmmmAw. NB7B5 A Compliments of Dr. and Mrs. T.J. Edwards Congratulations Compllmenls SENIORS of From Crown Iron Mr. and Mrs. C. M. Boclin Company 7166e7z'7feze,,. X -.:- f :,,. vt fix. i j 1. .QA -1 SWEQK Best Wishes to the Senior Class and The 1950 Mustang Stott i t Peter cmd Mr. Revsbech
Are you trying to find old school friends, old classmates, fellow servicemen or shipmates? Do you want to see past girlfriends or boyfriends? Relive homecoming, prom, graduation, and other moments on campus captured in yearbook pictures. Revisit your fraternity or sorority and see familiar places. See members of old school clubs and relive old times. Start your search today!
Looking for old family members and relatives? Do you want to find pictures of parents or grandparents when they were in school? Want to find out what hairstyle was popular in the 1920s? E-Yearbook.com has a wealth of genealogy information spanning over a century for many schools with full text search. Use our online Genealogy Resource to uncover history quickly!
Are you planning a reunion and need assistance? E-Yearbook.com can help you with scanning and providing access to yearbook images for promotional materials and activities. We can provide you with an electronic version of your yearbook that can assist you with reunion planning. E-Yearbook.com will also publish the yearbook images online for people to share and enjoy.
