Torrance High School - Torch Yearbook (Torrance, CA)

 - Class of 1932

Page 1 of 124

 

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1932 Edition, Cover
Cover



Page 6, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 7, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 6 - 7

Page 10, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 11, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 10 - 11

Page 14, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 15, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 14 - 15

Page 8, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 9, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 8 - 9
Page 12, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 13, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 12 - 13
Page 16, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collectionPage 17, 1932 Edition, Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection
Pages 16 - 17

Text from Pages 1 - 124 of the 1932 volume:

Y My W -3 DW? MMl1ii3a .W WWW4? Zi Wd . f W d, EMF' KW gy MT 34 4' 'if,L2Swf'X""' MW THE TORCH VOL- 7 I 1931 TGRRANC HIGH SCHGOL Published Annually By Associated Student Body TORRANCE CALIFORNIA Dedication THE players on the stage customarily receive due honor for their efforts, but We sometimes forget that "they also serve Who only stand and Wait"g therefore, to "those behind the scenes," Whose help is so essential, We dedicate this book, the 1932 Torch. Foreword AS the curtain falls on the last act of our school year, vve,the staff of the Torch, pre- sent to the school this book, which is a surn- mary of events that have happened during the past year. It is our sincere wish that you will find this volume, the 1932 Torch, "As You Like It," according to Shakespeare. PM Tab le of Contents I Qi I Theme: . . "All the worlellr ez stage, And all the men and women merely players." FOREWORD DEDICATION ACT I INTRODUCTION Campus Views Faculty Classes Seniors---"All's Well That Ends Well" Juniors---"As You Like it" Sophomores---"Much Ado About Nothing" Freshmen---"A Comedy of Errors" Sth grade ACT II ACT III ACT IV ACT. V 7th grade RISING ACTION Student Organifation 1 s Honorary Socie f Student Clubs Publications Dramatics Music Activities CLIMAX Poems Stories FALLING ACTION Boys' Athletics Football Basketball Track ,Tennis Golf Girls' Sports CoNcLUsIoN Humor Advertisements C ff p ! 4 r -,.,. MY E q We 5 13 f Vi ? fi V J -3 213 Z X ,, , N 5 WHATEVER THE PART which may be yours to play upon the stage of life, play it, live it, give it the best you have. Throw yourself with boundless energy into your part in life's activities and you can not fail, success must be yours. HERBERT S. WOOD O THAT GROUP of young players who are about to make their final bow before the curtain goes down for the last time in the stimulating drama of their high school life, we offer our congratu- lations. ln the brief time we have known them, they have proven themselves actors of worth, sk'lled in interpreting the roles which have been given them. The principals have played their parts with sincerity and purpose, and, supported by every member of the cast, have succeeded in making a production which is noteworthy, of high standard, and prophetic of future success in that greater rlra- matic venture of adult life. ELIZABETH PARKS. Cjaefs-:X .1 Aft X Q, I HELEN COLLER Wellesley College Columbia University Home Economics ELEANOR BOICE Torrance High '25 Secretary EGBERT MERRILL New Mexico College of Agriculture Science, Agriculture P a g e T w e l v e M c acultv G. L. MOWRY GRACE H, GRANGER University of Michigan Oberlin College Science, Mathematics Mathematics FLORENCE BEHR MARGUERITE E. Smith College JONES Library, University of Vermont Commercial KATHERINE STELLA M. YOUNG MILLERD Stanford University Grinnell College Social Science Mathematics EVA JONES University of Vermont History, Civics Geography ADA M. P. CHASE Art Institute ofChicago Columbia University High School Art Stage Art GRACE MORSE University of California Berkeley Latin, English Part of WILLIAM THURMAN, Physical Education Year BAYARD BROOKS, Printing 5 s X TORRANCE HIGH SCHOOL QL ,Q , FRANCIS EDITH P. KELLY MRS. LOIS ENGEL W. S, WRIGHT WADDINGHAM Stanford University Univ. of Washington University of So. Calif. Occidental College E 1' h J 1' Univ. of Southern - Universitv of Southern ng is ' Duma lsm California SPi'm5h , California . I General Science Science Mathematics Dmmancs Social Science SARA VAUBEL EARL FIELDS JESSIE E. WEAVER Illinois State Normal University of California Los Angeles Teachers' University at Los Angeles College University of Southern Coach of Athletics Woodbury Business Cggiornial 1 Physical Education Cgllfgc . I mercia ommercia KATHRYN KLEIN HELEN COLLINS IRENE MILLS WILLIAM BURK Sargent School for Torrance High '23 University of Southern Bradley Polytechnic Physical Education Secretary California Institute Physical Education English Michigan State Normal School Wood Shop Page Thirteen ls I THE TORCH, NINETEEN THIRTY-TWO MARY CLAUDIA HERBERT ANDREWS ETHEL R. BURNHAM HOWARD WH-I-SON Marietta College. Ohio University of Wisconsin BURCHETT Central College for Tabor College, Iowa Univ. of Washington State Teachers College WomengState Teachers' Prim in E1 ugh Santa Barbara College, Missouri Y g 'g Mechanical Drawing Clothing Electricity Sheet Metal LEONARD AUSTIN ' CORA MABEE RAYMOND R. SMITH Umversnf' 0fCa11f0fH12 University of Southern University of California 2-Oi Angeles Twhffs California at Los Angeles Ruigeshop Mathematics Coach of Athletics Vocational Science Physical Education and Mathematics MABEL TAYLOR BERNECE DAISY KOEHLER MARJORIE EISCHEN BOYNTON SUMERWELL Torrance High '26 University of California University of California University of Southern Junior Clerk Berkeley Berkeley California . Music Spanish Arr Page Fourteen THE TORCH, NINETEEN THIRTY-TWO eietleirie?-E"!"E"!"ZnInZeZn!rrZeZn!nZrr2sr':-w'-i'"'''ninirrinininieinisfIss?EoinEoin?IfZeleiwisei-E"ZfIe!eZe!+!-+Z+s!++5"!"3''IKM''E"!"Z' Vocational Auto Shop Years ago when the automobile game was young, it was the general practice for a mechanic to know how to back a nut off of a bolt and take the part being re- paired over to a bench, hammer on it for a while, maybe bend it a time or two, then replace it by putting the same nut back on. The mechanic many times did not know what was wrong with the part he was repairing, and was taking a chance on hammering and bending it, trusting to luck it would work. This type of mechanic in the automobile world is the well known "grease monkey". The purpose of the vocational auto shop class is to eliminate the above from the automotive field. Mr. Austin, instructor of the vocational work in the high school, after com- pleting a mechanic arts course at Santa Monica High School, owned a garage for sev- eral years, worked for other concerns, and also attended a trade school. With this experience Mr.Austin knows just what the boys taking this course should be taught in order to be better than the "grease monkey" type of mechanic. Our high school shop is well equipped to give its students the necessary amount of model work needed. Students must complete their model practice work on the shop models before working on cars which are brought in every day by indi- vidual students. Five boys of the midterm graduated from school with majors in vocational auto shop and are qualified to enter the automobile trade at various stages, These are as follows: Norman Barck six hundred hours,Jacob Gall nine hundred hours, Richard Mason twelve hundred hours, Willie Agapito and Sadao Wadamoto each with fifteen hundred hours of shop work. This term the shop work progresses as any general repair shop during the vocational periods. The class now consists of the following boys: Simon Schipper and Robert Hannan fP.G,'sj, Francis Dean, Carl Eiesel, Elmer Riley, Albert Curler, Andrew Cline, Herman Hamman, George Figueredo, Chikara Kazama, Bruno and Emielio Adamoli, Susumi lshikawa and Massaki Shimatsu. Boys, Physical Education The program set up by the Boys' Physical Education attempts fundamentally to coincide with the basic aims of physical education, namely: a long life, physically lit, morally sound, mentally alert, hygienically clean, and a good citizen. However, overshadovving all of these basic aims the program attempts to give the boy goofl wholesome recreation so as to enable him to relax and to be placed in an environ- ment which relieves him from the more formal routine which he must experience in his academic classes. The program attempts to emphasize recreation and good wholesome fun-equally as much as it emphasizes the basic aims of physical educa- tion. The activities of the physical education procedure are based to a certain extent upon the recommendations as prescribed by the physical education department of the Los Angeles school system. This outlineis divided into five main divisons: self-test- ing, game fundamentals, apparatus, games, and beautiful living. As this procedure Page Fifteen TORRANCE HIGH SCHOOL indicates games, one could say recreation occupies the larger percent of the program- which is very essential in the high school routine. Torrance is fortunate in having a large and well ventilated gym with adequate facilities, all the modern equipment is on hand including apparatus, balcony bleachers, equipment and apparatus rooms, basketball courts, handball courts, and volleyball courts. The out-door facilities are equally as appropiate. This includes a marvelous playing field surrounded by a Well graded track and having high-jumping, broad- jumping, and pole-vaulting pits within its outer border. There are also out-door handball, basketball and volleyball courts. Torrance High has been often congratulated upon its excellent phvsical education and athletic equipment, facil- ities, and environment. Business Department Whether it is because of that much repeated word, depression, or because of something else, the business subjects were very popular this last term. Be that as it may, more students were taking a business course this last semester than ever before. The heads of each department are: Business Training, Miss M. Jones, Typing, Miss Vaubel and Miss Weaver, Bookeeping, Miss Weaver, Shorthand, Miss jones and Miss Weaver, Comptometer, Monroe, and Bookkeeping machine, Miss Weaver, Business English, Miss Mills, Stu- dent Store, Miss Jones, Business Office, Miss Weaver. Not only are there positions open for girls, but many oflices call for boys who have had business training. No matter if one is going to college or to work, a knowledge of some business methods is essential to making a living. English Department The students of the English Department in Torrance High School this year have been engaged in four activities. 1. Manipulating the rules of grammar and composition to improve their style of speaking and writing. 2. Venturing timidly into the realms of new words to enlarge their vo- Cabularies. 3. Adventuring joyfully with the delightful characters of fiction to increase their understanding of life. 4. Evidencing joy in pioneering undauntedly into the elective course of Senior English to appreciate more deeply their great heritage of English literature. The instructors are: Miss Mills, Miss Burnham, Mrs. Kelly, Mrs. Engel and Mrs. Morse. Girls' Physical Education Through physical training the Girls' Physical Education department aims to develop a sound nervous system, to give social development, character training, and a desire for health. Miss Klein and Mrs. Morse are the instructors. Page Sixteen THE TORCH, NINETEEN THIRTY-TWO 'Mrr2rr!++2++I-'I'tieittietleieielfIeieZeI+-I+Z+!+!rIrXfffft!eIr!e5ttZreZe!eEetitritieieleIeinIrie-Inie!r!rZeI+!+!eIe!eZ+Ie!m!eZeEeittietie-Z' History Department The History department finds itself busy with large classes, full outlines, and interesting work. Earnest students realize that history is not only a cultural subject that will assist them in their understanding of literature, music, and present day problems, but that, rightly studied, history will help them in their own life problems. "History repeats itself," and the problems of individuals and nations are much alike. Therefore lessons may be learned from the mistakes, the accomplish - ments and the triumphs of past people and peoples of history. Instructors, Miss Mabee, Miss E. Jones, Mrs. Young. Home Economics Department The Home Economics department offers courses in clothing, food, nutrition, and home management, the aim being to train the pupil in the art of home making. There are about one hundred and fifty pupils enrolled in the department. A weekly display of garments made in the clothing department, besides many unusual exhibits, has been arranged by a student committee from the clothing de- partment. The committee for the first semester consisted of Olga Jaunsem, Katherine McNeil, Isabelle Burdick, for the second semester, Pal Marie Henry, Ethel Ward, and Alice Gall. To those earning scholarship in the nutrition class is given the Red Cross Nutrition Certificate. This year twelve certificates were given. The instructors are Miss Willson and Miss Coller. Language Department Latin "Ad astra per aspera," "to the stars through difiiculitiesj' might be written as a brief and complete story of Latin in Torrance High. And we do not claim to have reached the stars even now, though our aims and hopes are high. The study of Latin was begun seven vears ago as a sort of extra-curricular activity for three ambitious students during the noon period. From that small beginning a department has grown, more and more joined the ranks, enlisted even in Caesar's legions, and fought his wars. Now there are three or four classes every semester, averaging from fifteen to twenty students. Very few plan to take more than two years of the subject. The aim is to give as wide an acquaintance as time permits with the language, customs, daily life, background, and history of Rome, a Working knowledge of derivatives and a greater understanding of English grammer and language. Teacher, Mrs.Morse. Spanish The direct method that was started two years ago as an experiment is now adopted throughout the school system. No book is needed. The method is entirely conversational. The results have been seen in increased vocabularies and greater facil- ity in the use of the language. The teachers are: Mrs. Boynton and Mr. Wright. Page Seventeen TORRAN CE H IGH SCHOOL f5+eI+Ief!1+!v!fi++I++ifeI"!"Z"Z' fieierieEe!H2"Z++Z+!e!+I++Z++2++I+E+-IrieZeeleeielvirieeifele'ie'iedflvivleieleie2eIf+Ze'v'e'+'mIe2e2fe3f4+4fr'ert Torrance High School Library Lord Macaulay has said, "I would rather be a poor man in a garret with plenty of books than a king who did not love reading". Those students who have formed the library habit during their high school years have gained a treasure which can never be taken from them. Our library contains a well rounded collection of over four thousand books. We subscribe for fifty magazines, many of which are later bound for the reference shelves. Library instruction is given to all students, so that they may learn to use books and other reference aids intelligently. A vocational course in library science is given for credit. This course is valu- able not only for those who think they would like to be librarians, but also for any one who is preparing for college. The following students have taken the course this year: Bertha Hinman, Dorothy Gramling, Catherine Mitchell, Vivian Carroll and Ruth Granger. The library is also grateful to those who have worked in the library without receiving credit. Several girls have stayed voluntarily after school because they wanted to help. Mathematics Department The Mathematics department offers a year of advanced algebra beyond the first year. It likewise gives plain geometry, and for advanced students a half year each of solid geometry and trigonometry. For those students not caring to take the regular two years of algebra cr geometry a year's course in general mathematics is given. A year of mechanical drawing may count towards a mathematics major. Instructors: Miss Mabee, Mrs. Granger, Mr. Waddingham, Miss Millerd. Music Department This year Torrance has a very successful mixed chorus singing a cappella fwithout accompanimentj and perpetuating the name "Madrigal Singers". The orchestra, though small, has been devoted to the highest ideals of ensemble playing. General music in junior high school has included sight reading and theory, the study of great musicians and their music, and also of the music of nations. Other music opportunities include glee clubs for junior high students and a course in music appreciation for students of tenth grade or above. Wood Shop Enrollment in high school wood shop classes has been larger than any pre- vious year. This course has probably been affected by the depression more than any other because students have to buy all the lumber they use. However, some very outstanding furniture projects have been worked out by students. Page Eighteen THE TORCH, NINETEENTHIRTY-TWO Y'LVL'49L'Y'L'494'L'L9L'L'L'L'4'L5L'L9L'4'L a'a'4faLJA':':Y:9: :9E i'5Q,J -.--4--r-4--v-rvvw--.--r-.--.-vw--.--.--.--.--.--.--.--.-- --if-.--rvm-v.--.--.W-.-.W-.--.-.-- we . . 4' "AIM Well That Emil' Well" SENIOR A-17. OFFICERS STEVENSON, LAWRENCE "A proper man ax an Stage Crew 2-3-4 :ball ne in a proper day' President of Class 3-4 President of Key Club 4 Football 3-4 World Friendship 3-4 ROELOFS, RY "Tbere' ill n :ll ei fuel' a Scholar i ' temple" Modes n - Presiden ' ls' gu Editor T.N, . 4 "Jonesy" 4 LUKES, BLANCHE "By my penuvgf af observation" World Friendship 3 G.A.A. 4 Treasurer of Class 2-4 Modes and Manners 3 Schumann 2 SACH, STANLEY 'Hfball I compare the: to 4 Jammer day ?" Class President 4 Stage Crew 3-4 Stock Judginf 1-2-3-4 World Frien ship 2-3-4 Key Club 1-Z-3-4 THOMPSON, LEROY "Tn unpathed wateri, undreamed xboru' Vice President of Student Body 3 Vice President of Varsity Club 3 President of Future Farmers 3 President of Science Club 4 Vice President of class 4 QQ? Page Nineteen U THE TORCH, NINETEEN THIRTY-TW'3 4' '-'iLi i'.'...9:!:9iY:1:'.A, .L .L J, J, ,Q AAAI. AAL .9 . 'E' fn- -.- -.- -.- -.Y v.- -.Y Y, Y, -,--,T -,mrF,-F,T,-5-5e5T,f,w,,,..,.gag.egLgLgLgLgLg+gig., -',.- -g+.g,,gLg+yegLgLgLgLgLg+g+giq..5..g,.g..g..g..g..5. PageTwenty BAKER, BERNICE "In the twinkling of an rye" Class President 2 World Friendship 2-3-4 G.A.A. 1-2-3-4 Schumann 2 l BARTECHKO, VAN. ' ,. f- I " : nad: much" Class Plays 1-2-3 'F df W H President World Friendship Club 3 .1 1 President Schumann Society 3 4' President spanish Club 3 -X ,,-J4, Madrigal Singers 2-3-4 BATSCH, MARIE "Unle:.r expzrienrz be 4 jewel" G.A.A. 1-2-3-4 Beauty Lovers 3 Vice President G.A.A. 4 Torch StaFf 4 BELASCO, MAR-IE "fb: that war :wr fair and never prnud' Beaurv Lovers' Club 2 T.N.T. 2 Girls' League 4 Torch Staff 4 Class Omccr 3 BRIGANTI, CONCETFA "A: rnergf ar tb: day ir lang' Beauty Lovers' Club 3 j ,A Girls' League 1-3 , il BURDICK, ELIZABETH "Nu legaq is ra rirb ur hanrrgy' Girls' League 2 Modes and Manners 2 World Friendship 2 BURDICK, ISABELLE "A wry riband in the :ap ofjoutb' World Friendship 2-3-4 , Schumann 3-4 Girls' League 1-3 Vice President ol Class 3 G,A.A. 1-2-3-4 CHRISTENSEN, JACK "I had rather have u foal to make me Basket Ball 1-2-3-4 merry, than experience to make me .rarlf Yell Leader 2-3 Golf 3-4 Madrigals 4 Varsity Club 3-4 CHRISTENSEN, RAY 'SLi1u an arrow rlmr' Transferred from Poly 2 CLARK, AUDREY "Merrily, Merrily, I live naw." G.A.A: 1-Z-3-4 Secretary of Class 1 CLUTTER, KENNETH "Answer ms in one ward" Key Club Future Farmers President of Class 3 Football 3 COKELY, LOLA "Oli, bow full nf brian' ir thi: Tennis 1-2-3-4 work a day world" G.A,A 2-3-l "Up in the Air" 1 Madrigals 4 Class President 2 TORRANCE HIGH SCHOOL SJ .!..!..!. 3. . . . . , . .Q7v7f7v79, ,Q7r7Q717070707v7f7v70:':0,O7O707v, v707o7Q7Q7Q707t7Q7!7Q7t7Q7 7 7 7 7 7 7 7 7 7 71717 . ."5'w--r -ra--rv -v r r -r 4- -rv -v v-f-v-rv'rv-r.--s-1-s-vw--r"r-4-'wa-'s 4- -v -s -4- -v -4- -v H - -r1-'rw-'vw-a--rw-v-1--I' ' COOKE, HARTLEY "I mlm' have liberty" l Key Club 2-3-4 World Friendship 2-3-4 Future Farmers 4 Stage Crew I-2-3-4 Dramatics Club 2-3 CRAWFORD, JEAN "Let the world Hide" G.A.A. 2-3-4 Quien Sabe 2-3-4 Torch Staff 4, T,N.T. 4 Girls' League 2-3 DAWSON, VIOLA "Tb: band that ba: made ju World Friendship 3-4 fair ba: made yen good" President of Beauty Lovers 3-4 Girls' League 1 ELDER, LENDEL "Tn entrap tb: wifes?" Varsity Club 3-4 Vice President Key Club 3-4 "jonesy" 4 Scholarship 3 Oratorical Contest 3 FIX, IRENE "The "why" if a.r plain ar Orchestra 1 the way to parirb church" Latin Club 1-2-3-4 G.A.A. 3-4 GALL, ALICE "Speak law, ifyau rpeak love" Class Secretary 1 Treasurer of G.A.A. 2 Baseball Captain 1-2 Girls' League 2 G.A.A. 1-2-3 GILBERT, STANLEY Forestry Club 3-4 Agriculture Club 2-3-4 World Friendship 3-4 State Crew 3-4 CARL GRAMLING Entered from L.A.C, Nov. 1930 Latin Club 3-4 Dramatics Club 3 GRAMLING, FLORENCE Torch Staff 4 T.N.T. Staff 4 Worl:l Friendship Club 3-4 Quien Sabc 3-4 "Hit carer are naw all ended" "H: who il ever wire" "A rbapxody of worm" G.A.A. 3-4 GUYAN, GENEVIEVE "Neither rhyme nor noun" G.A.A. 1-2-3-4 Aviation Club 1 Schumann Socity 3-4 Aggie 1-2-3-4 World Friendship Club 3-4 HENRY, PAL MARIE "The gran Jtanpr nat, Class President 1 rhe madr an it ra ligbtb' Modes and Manners President 4 Girls' S-lf Govt. President 4 Girls' League Representative 1-3 Art Editor of Annual 3 HINMAN, BERTHA "A merry heart gal: all the Jay" Class Secretary and Treasurer 2 President of Scholarship 4 Latin Club 3 Editor of Torch 4 World Friendship 3-4 Page Twenty-one THE TORCH, N INETEEN THIRTY-TWO fifnvifnsni H ..Q..f.... n4nvJavJJ,.',,...Q......,.,,.' Lf,1...4.1..'.,f..,..e.44,.',.',. 4 rx s 4 r- a"o'1"4'r'v'o"o"r'4?aTo'aTAfoT4TFFu?4?4'sTlTsTaTa''cwafa' age Twenty-two ,nt ...n.n.1.1.a.,a. ., f-.-mu. NICKERSON, SYDNEY "There'r the homo of if' Secretary Future Farmers 3-4 President Aggie Club 3 Plant Identification 1-2-3-4 Hi-Y 3-4 Basketball 1 NOURSE, ROBERT "Patch grief with prooerhru Scholarship Society 1-2-3-4 Chief Stage Electrician 2-3-4 Key Club 3-4 World Friendship 3-4 Torch Staff 3-4 PFLUGH, JOHN Key Club Baseball 4 Football 4 Varsity Club Senior A Class President W'32 RILEY, ELMER "A lion among women Football 3-4 if a mort dreadful thing" Class Plays 3-4 Vice President Varsity Club 4 Vice President World Friendship 4 Basketball Manager 2 ROWELL, TRIXIE Aggie Club 1-2-3-4 Schumann Society 3-4 G. A. A. 1-2-3-4 Future Farmers 2-3 Madrigals 3-4 TURNER, VIRGINIA "The rude Jea grew civil at her Jong" Quien Sabe 3 World Friendshi 2 The "Ghost Bird," G-.A.A 4 Madrigals 2 STEVENSON, DOROTHY 'gLeI'.r go hand in hand, not one Latin Club 1-2 before another" World Friendship 2 Treasurer Girl's League 4 Glec Club 2 V WALKER, VIRGINIA "A mirror of all tourtexj' Aviation Club 1 Schumann Society 3-4 Aggie Club 1-2-3-4 WILHELM, RUTH "A rieh jewel" President of Girls' League 4 President of G.A.A. 3 "Ghost Bird" 4 "Virtue ir hold, ana' goodnerr never fearful" "jonesy" 4 YAMAMOTO, ARTHUR "I eeula' have hettef :pared a hetter Advertising Manager 4 man" President World Friendship 4 Captain Basketball 4 Spanish Club 4 Key Club 4 ZAMPERINI, PETE "The hettef part of direretion ir valor" President of class 1-2 Madriga!s 1-4 Varsity Club 1-2-3-4 World Friendship Club 3-4 Key Club 3-4 TORRANCE HIGH SCHOOL winireirtinininxktininitrZ+r2rrZ+r?rZrw'e+'fn!+Z+!+rZnI+IaZeEnI+Ie2rtE"5"5"E++'i++Z'-Ere!-rxw' "A "' "A "' ''ninielaininlnleirri''Z"'r'Z"I"'r'!"i"Z- HUDSON, JEAN 'gI'll not budge nn inch" Entered from Poly High, Long Beach G.A.A 2-3-4 Student Officer 1-2-3-4 JAUNSEM, OLGA "Ar gage! lurk will have it" G.A,A. 2-3-4 Aviation Club 1 Girls' League T.N.T. Staff 3, 'Iorch Staff 4 KING, DOLORES "My heart ir rrue ar nee!" Secretary of Student Body 4 Scholarship Society 4 Modes and Manners 4 World Friendship Club 4 G.A,A. 1-2-3-4 KIRCHNER, ARBELLE "Here'J me hand, And mine Circulating Manager ofT.N.T. 4 with my heart in ir' LINCOLN, MARGUERITE "AJ :haste at unxzmned rnowrn President of Scholarship 1 Secretary of Quien Sabe I Manager of Orchestra 1 "Jonesy" 4 Modes and Manners 2 LOCKHART, MELVIN Treasurer of Student Body Z Modes and Manners 4 "JOnesy" 4 "The Ghost Bird" 3 Commissioner of Oral Arts 4 LOFTUS, WILLIAM "This ii' the lang and rhart of it" Quien Sabe 3-4 Treasurer Key Club 3-4 Hi Y 3-4 Basketball 1 Track 2 MCNEIL, THOMAS "Cnndemn the fault nnd nat the President of Student Body 4 Torrance Aggies 2-3-4 President of Forestry Club 2-3 Secretary of Science Club 2 President of Aggie Club 3 MERRIAM, FLORENCE "A violet in the youth ef prime Secretary of Class 1 Student Officer I-2-3-4 Dramatics Club 2-3 Annual Staff 3-4 T.N.T. Staff 3-4 . MONTAGUE, CHARLES "I have gained my experience President Key Club 4 President Boys' Self Gov't 3 Scholarship 1-Z World Friendship 3-4 Spanish Club 3-4 NADY, MARY 'Tmaoth rum' the water where the hrnok ii' Student Body Council 3 dw?" Editor of T.N.T. 3 Modes and Manners 4 "jonesy" 4 Secretary of Girls' League 3 NEVILLE, CLETA Latin Club 3 World Friendship 3 Modes and Manners 1 Girls' League 2 "fha if well pale' who ir wel! mti.rfed" actav a f it" nature ' ' "Tr1ethi:truth" Page Twenty-three l P TORRANCE HIGH SCHOOL giqz49i ',.'u:..9 3,2 ,LJlla'Q'ig?372'QA'AVQYQVLYLVQVJVJYQVQJVQJVQL'4'7','4'l'l'4'l L 4 4 , if 4',',','Q:':M . 4 ra . .--.--i--.--f-.--.--1--.--.-.-. -.--.--.--.--.--.-.--.--.-.--. .--.1-.--. . . .--rv-. -- -- -1- . .-.- . .--.- ageTwenty-fou AUSTIN, MILDRED "l'll Jpeak in a mrmxtrour little Wire" World Friendship Club 3-4 Head of Speedball 3 G.A.A. 4 Schumann DEANE, FRANCIS "BrwiU i.: ill: .mul of wit" Football 2-3 Boys' League I-2-3-4 FRAZIER, LILLIAN Madrigal Historian 3-4 President of "Inter Nos" 4 G.A.A. 1-2-3-4 World Friendship 3-4 Art Editor T.N.T. "I: .rlve HJ kind EJ .rbe if fair?" HATFON, ROSS "L.'t'.r male: an honorable rctrzaf' Key Club 3-4 Track 3-4 Baseball 3-4 Hi-Y 3-4 Mc'I'AGGART, BOB "Give tb-y thought: no tangle" Key Club 4 Spanish Club 3-4 World Friendship Club 4 Basketball 3 MOCK, JOHN Varsity Club 2-3-4 Science Club 4 "A man can die but mm' Football 2 PAISLEY, CYRIL "Haw far that little candle tbruuu in light" Key Club 4 World Friendship 4 PATCHIN, WILBUR Science Club 4 Spanish Club 4 World Friendship 4 STADIG, MARGARET Vice President of Spanish Club 3 "I: JL: nat pai-.ring fair" PRICE, HORTENSE G.A.A. 3-4-5. Entered from Pasadena Hockey 3-4 Baseball 3-4 Basketball Z-3-4 SWEENEY, LEO Football 2-3-4 Baseball 3-4 Secretary Boys' League 4 President Madrigal 4 Varsity Club 2-3-4 WATSON, RICHARD "From the crown of hir bead ra the Student Body Store 3-4 :ale uf bi: fm be i: all mirth" "Thy laugh that win" r TORRANCE HIGH SCHOOL LLKKAMALOAQLQL J!:!:!:tiQ494vLv:Q,.p..!. 0 ..LJ..v..Q..Q..v..t..f..9m!.J..v..t Q,,y,,f..v..!..f..Q.,0 1.3, .. .. ..0..v..Q.. V -W We -W -W -- A H -- - .- . a.f.f.f.f.f.v.a -.f.f.f.f.ff.f.f.f.a.a.aF T T Senior Class Will and Testament We, the class of S'32, being sound in mind and body, as far as we are able to un- derstand these terms, hereby solemnly bequeath to the juniors, sophomores, freshmen, eighth graders, and seventh graders, our mental and physical abilities and shortcomings, individually: I, Mrs. Granger, will my class of S'32 to the cruel world, hoping she will treat them kindly. I, Miss Mills, will my tears over losing the brilliant girls of my S'32 home room to whomever they may chance to 'meet in their future life. I, Mildred Austin, bequeath my curly locks to Dorothy Gramling. I, Bernice Baker, leave a smile for everyone. I, Van Bartechko, will my quiet ways to Alfred Bunje. I, Marie Batsch, leave my knowledge of how to manage men to Georgia Higgins. I Marjorie Belsaco, leave my job of writing "Peppy Personals" to anyone who is pepping over with ideas. I, Elizabeth Boyd, bequeath mv heap big oil man to Helen Haworth. I, Concetta Briganti, leave my love making ability to Louise Failla. I, Elizabeth Burdick, will my gracious ways to Mary Peckham. I, Isabelle Burdick, leave my giggle to Miss Parks and my scream to Mr. Field. I, Jean Crawford, bequeath my English ability to Fred Curler. I, Jack Christenson, leave my golhng ability to Miss Burnham. I, Ray Christenson, will my lid to anyone who looks as well in it as I do. I, Audrey Clark, bequeath my ability to tap to Louise Strawe. I, Kenneth Clutter, leave Mrs. Kelly looking for another good editorial writer. I, Lola Cokely, leave my ability as a tennis champion to Homer Kirkpatrick. I, Hartley Cooke, bequeath my studious ambitions to Thomas King. I, Viola Dawson, will my demure ways to Elsie Price. I, Francis Deane, leave my entertaining ways to Mrs. Engel. I, Grace Denny, leave my student oihcer pin to Raymond Mullaney. I, Lendel Elder, leave my oratorical ability to Bill Burkett. I, Irene Fix, will my poetical ability to Helen Mclvlaster. l, Alice Gall, will my knowledge of Dietetics to Aggie Lou Rippy. I, Stanley Gilbert, bequeath my scientifc knowledge to Wendel Leatherman. I, Florence Gramling, bequath my rattling tongue to Vivian Carroll. I, Genevieve Guyan, leave my ability in comptometry to Lucille Thompson. I, Pal Marie Henry leave my position as president of the Modes in Manners Club to Ruth Banks. I, ,lean Hudson, will my senior English Composition to any desperate junior Qljreferably Ethel Sleppyj. I, Bertha Hinman, will my way with the other sex to Millicent Lincoln. I, Olga Jaunsem, leave Mrs. Bell looking for another honest cashier. Page Twenty-five THE TORCH, NINETEEN THIRTY-TWO .f..v..v..v,- .. U . .. .. .. , v..y,.Q,Q,,,,'-.JJ-Aonyiy..ynQh,..,mmmyhfhm+ y..fmnfnf2QnvLLomanrh f..y..,..f. a..z..x..Q..y..1..q..y. Q 1.1.4, v Q .L 'f"r'r r'r-v-rw-'r-s- wwfvvw-'x"v's"x'v'r-a'-rv'vw"5"s"v'vvv'rr-rvv-r-f"x"c"s"x"f"x--s--vaffffffg-x"x-'i"5'fFiff I, Dolores King, leave my place in the senior class to any little junior. I, Arbelle Kirchner, leave here to join Willie. I, Marguerite Lincoln, leave my sisters in care of the boys in the orchestra. I, Melvin Lockhart, bequeath my athletic ability to Margaret Kibbe. I, William Loftus, will my cute little mustache to Bobby Elder. I, Blanche Lukes, leave my long years of practice as treasurer to any one who feels in need of them. I, Thomas McNeil, will my dancing ability to Cecil Bishop. I, Florence Merriam, leave my interest in George Washington High School to any girl who finds it interesting. I, John Mock, will my Ford to any good auto mechanic. I, Charles Montague, leave my position as Boys' Self Government president to Jimmie Miller. I, Mary Nady, leave my brother in care of all the girls. I, Cleta Neville, will my Eastern accent to anybody who thinks he can master it. I, Robert Nourse, leave my excess brains to Earl Doner. I, Elmer Riley, leave all the teachers broken hearted. I, Margery Roelofs, leave and am glad to get out. I, Trixie Rowell, will my senior sweater to any under classman who dares to put it on. I, Stanley Sach, bequeath my side burns to Ralph Montague. I, Dorothy Stevenson, leave my joking ability to Hal Smith. I, Lawrence Stevenson, leave with Virginia Turner. I, Leo Sweeney, leave Coach Fields wishing there were more like me. I, Le Roy Thompson, leave my luck just before football games to any one who hasn't suffered with broken bones. I, Virginia Walker, will my ability in short hand to Aldine Brown. I, Ruth Wilhelm, leave my public speaking ability to Louis Briganti. I, Arthur Yamamoto, will my position as advertising manager to Jacqueline Rogers. I, Pete Zamperini, bequeath my tactfulness to Alice Burger. We, the class of S'32, do hereby atiix our signature and seal to this document on this fifteenth day of February in the year of our Lord nineteen hundred and thirty-two. fSignedj CLASS or S'32 I solemnly aihx my signature and the seal of California to this last will and testament of the class of S'32 of Torrance High School. The testarors to the best of my knowledge are in sound mind and fully understand the acts to which they have affixed their name. Sworn to before me this Hfteenth day of February in the year of our Lord ninteen hundred and thirty-two. I. WILL TELLEM, Nor-Amr REPUBLIC. Page Twenty-six TORRANCE HIGH SCHOOL aggggyggagggggggggggqawafmb -',.,- -fggggggg. .gl :gage .gggggggsegggggagaggggggggggggggffggggggggggggggggrg'g'g'g g'gfg'g'g'.,ggg+p 1 Summer 3 7. Class Prophecy Time 1945 Place-Aboard Zipplin "Hu, ------,-,, -,,,-,,-,, , ,,-,,,.,,, , ,,,,,," As the curtain rises, we discover a comely maid dressed in a black and white uniform, busily dusting the lobby. We recognize her as our old friend and class mate Genevieve Guyan. As she continues dusting, the porter comes in-still playing the butler, Hartley Cooke, He stumbles over her duster. A great argument arises. The captain rushes in, still the dignified captain of our class. He is still settling feuds- Lawrence Stevenson. As the melee calmed, we find all the passengers in the lobby. We couldn't fail 'to recognize our old friend Marie Batsch, who is on her way to Paris. She is doing the buying for one of the exclusive womcn's shops on Seventh Street in Los Angeles. At the further end of the "Zip" hysterical screams arise, as if from the effects of anightmare. We recognize the voice as Cleta Neville's. She is madly calling that she can't find her parachute! Cleta seems to be a famous woman transport pilot who is headed for Paris to establish a European air line between Torrance and Lomita. Here we also find two people in horn-rimmed spectacles. Kindred souls, both interested in the same weird subject. On close discernment we discover Charles Montague, and Blanche Lukes. Charles is a professor of anatomy while Blanche is his secretary. Next we notice the former Irene Fix, who, in these last few years, has ac- quired a great deal of wealth through Torrance oil. She has, as her companion, Le- Roy Thompson. He is still gigoloing around, and brightly entertaining the ladies. A radio announcement of the ship-board's festivities quiets the crowd. To our surprise we recognize the voice to be that of our loud speaker of former days, Mr. Robert Nourse, who is the radio engineer of the "Zip." An announcement is made that the first thing on today's program will be the daily exercise led by john Mock, who is athletic instructor aboard ship. The curtain falls on a peaceful lobby. ACT II - The curtain rises on a scene in the lobby. It is about two in the afternoon, Each person is busy with the different entertainments of the day. In one corner we find two of our old friends, Arbelle Kirchner and Ruth Wilhelm. They are both busy writing letters. We are not sure to whom but we have our ideas. Ruth is an artcraft teacher, and Arbelle a sports editor for the news- paper. Both are on their way to Europe to spend their vacation. just then in walks a very distinguished personage. He seems to be the celebrity aboard ship this trip. He is setting the styles for men, dressed in the very latest. He is on his way to Paris to leave Enal instructions at his men's shoppe. His home is Hollywood, which he prefers to Paris. Oh! I almost forgot to tell you who this notable is, none other than our leader of gentlemen styles, Pete Zamperini. It always was what Pete wore, and it still is. Zamperini is the man's vogue. As his secretary we find Florence Merriam, Page Twenty-seven THE TORCH, NINETEEN THIRTY-TWO Wi-'9 --'L'49i'2Q929:9:'21:' -'LVLVL'L9gL'4'4'l'i'Q'i' M' "J!JY:!:929:'L'2Y2!..X.. ..!. 0 -'LLL -Y--9-JJYQL he insists that she travel with him, as his correspondence, including fan mail and such, is so great he cannot possibly handle it alone. What next! Can you imagine again-honeymooners-well, we might have known '32 was leap year. None other than Miss Henry. She and her doctor husband are making an artistic tour of Europe. We can not quite recognize her husband, but we feel sure he was a post-graduate in '32, The afternoon is busily spent at tea and bridge. At one table we find Lola Cokely, Marguerite Lincoln, Jean Crawford, and Grace Denny. They are absorbed in a game of contract bridge. The girls are all school teachers touring Europe on their vacations! You know these wealthy teachers! In a little time we find Dolores King and Mary Nady. What do you suppose they are doing? Well, you would never guess! They are in evangelistic work. Both loves to help missions and are saving many souls. On the observation car we see Bertha Hinman, still with a manuscript and a pencil, hunting all over the "zep" for personages. She is editor of the magazine "Hooey." Ah! much to our surprise also we find Stanley Sach, Sidney Nickerson and Stanley Gilbert standing in a group talking, they are in business together, but no longer future farmers, they are now present farmers, trying to cultivate non-slide banana skins. Just about that time through the "Zep" could be heard a familiar voice yelling-gum, peanuts, pop-corn. And who do you suppose it is? Concetta Briganti- but she gets the business in spite of the depression The curtain falls on a 1932 class reunion, finding that so many all are aboard. ACT IH A formal dinner dance in the dining room. As our "Toast Master" we have none other than Ray Christenson, who is at present an orator and public speaker. All the girl class members look almost as lovely as they did some years ago at that long remembered evening in June 1932. As dinner is served, we are entertained by the most elite group of dancers-Marje Belasco, Audrey Clark, Alice Gall, and Olga jaunsem, they are returning to Paris after a tour of America. All around the room are seated our old friends, honey-mooners, teachers, dancers, styles, etc. Why-if-there isn't Elmer Riley and Viola Dawson. They are both prominent now. Elmer made his million in telling bed time stories over the radio, and Viola sings. At the table next to them are seated Florence Gramling and Jean Hudson. The two girls have just opened a beauty salon in Hollywood and are returning to their original one in Faris. Next our "'Toast Master" said there would be a trip-The last survivors of the Madrigals. We recognize them as none other than Trixie Rowell, Bernice Baker, and Margery Roelofs. Behold! The three musketeers sit far over to the left-the three famous bach- Page Twenty-eight TORRANCE HIGH SCHOOL tsnrnvEvlmvLv..x..s. .vg4LvaQ..snvEvnvnvLv. 1. 1-vga' .favimarnfavnfavLmnvnfnvnvnvavarafgafnrnvn B Bragg L JB 2 5 B eg s 4' wr-vw--s rv-rw-'rvvw-w-vw--v-Fx"x"z--4--vw vw vvvwv wrt--vw-'rww-vw-rrv . ws vw--v-vvvv sv . . . A A elors, known for their wealth and hatred of women. The three most handsome of the class, and yet bachelorsg we don't understand. They are Mr. Jack Christensen, Mr. Lendei Elder, and Mr. William Loftus. They made their money as follows: Lendel Elder, cartoons for funnies, Jack Christensen, ushering, William Loftus, well, he made his own. Seated at the other table are Melvin Lockhart, Isabelle Burdick, and Elizabeth Burdick. Melvin is Pa1's husband's private secretary, but must keep faded while they honeymoon. As you know, Pal had more nerve than Melvin and beat her to marrying her boss. l Isabelle, also wanted to be a doctor's wife 'cut they ran out of doctors so she took up the profession herself. Elizabeth is a comptometer operator. As the wee hours draw near who do you suppose is just arriving? Elizabeth Boyd and Dorothy Stevenson. They are touring as they lecture on history subjects etc. Our 'Toast Master" says that there are two members left. One a tap dancer and the other a solo. The first is byArthur Yamamoto and the other by Virginia Turner. They are both playing the stage. As the curtain falls on our performers, so is it about to fall upon the happy class reunion of Summer '32, One moment! Our helpful and understanding class teachers! They have been enjoying the evening from choice seats, but refused to say a Word. Mrs. Granger now speaks, and tells us that she has never found another class like '32, Miss Mills next addressed her beloved students, and told them that while teaching at Torrance High she had learned to love children so well that she has chosen a rnatronship in an orphanage as her life's work. So the curtain falls on a happy and jolly scene. 1 ' . 1 , . ,fu ln - ' ' I ' -r ,P . . -V - , .n- ff. 1 , U , 4 e- ' V C ,Q f r. 1 . , , lungs' ' , 1 -I I 9' " 1. .V , U ,, A ,, spzaifgf.. - " Pfsfvaa-+1 1 -ialefveaffxf ,. , ,f ,, - , s A 'Lf' F"-'Fifi - ' 5'h":5?'.'1 QQ- 39141.13-.':i.'P1 ' ' , , ,. - sv-2 " '--f?:fZiffA,,l?s.f-.-My 2:5125 -. 'ggi Page Twenty-nine THE TORCH, NINETEEN THIRTY-TWO 1 Avgmfmvavnfnmvnrn !m..rncne4l0L'nm'nvnvnrnvgmrnvmfmvmvnvA .vnvnvnvnvnnmvifnvn E L .. E 9 1 'r'.'fvw-'fvf a--rr rv-v1'1-v-rw--rv'wrvw-vvw'-4--s-w--vwwww-4--r-a--r-w -- -- -- -' - ifeinirininlnlninirtinlfifi' we Sunday, June 12 Monday, June 13 Tuesday, June 14 Commencement Week . . . . . . . . . . . . . . Baccalaureate Sermon Rev. G. G. Elder . ........ Alumni Home-Coming Day , , ,,,, . Class Day Wednesday, june 15 . , Junior High Graduation Thursday, June 16 , . . Commencement Commencement Program PROCESSIONAL , ......... , ........ Class Invocation . . . , . . . . . Rev. K. J. Winkler Vocal Solo, "Trees" . .... . . . . . .Rrubnflr Marie Belasco Solveig's Song ........... . Grieg Which Is the Properest Day to Sing .... , . Arne Madrigal Singers Oration, "History of the Olympics" ..... . Bertha Hinman Vocal Trio, "Dark Eyes" ................ Rnxrinn Bernice Baker, Margery Roelofs, Virginia Turner Oration, "Modern Olympics" .............. Lendel Elder Vocal Solo, "Two Grenadiersn ....... . . Schumann Van Bartechko Oration, "Women in the Olympics" .... . . Ruth Wilhelm Violin Solo ........ ........ M arguerite Lincoln Presentation of ScholarshipHonors . . Miss Irene Mills, Sponsor, Ch. 121 C.S.F. Presentation of Ephebian Rings . . . Miss Elizabeth F. Parks, Vice Principal Presentation of Class ...... . . . Mr. Herbert S. Wood, Principal Presentation of Diplomas . . Mr. L. C. Dale, Member of Board of Education RECESSIONAL .................... Class Page Thirty Informal Reception in the Patio TORRAN CE H lGH SCHOOL '2"Z"Z"Z"Z"I" I"Z"Z"I''I''Z"I"Z"Z"Z"Z'4"Z"I"a'f6+e1"i"!"2"!"3+r!++I++2i+I"i+tI+!eIeZe!eIeX+'e'+?-Serif?'i'4+sI++Z"i"Z'4'4"Z- Class Will of W '33 Beryl Talent leaves her A's to John Selby so that he won't bother to come to school any more. Bill Lanz leaves the track to "Feet". Paul Getz leaves his fast Ford to Louie Briganti. Cyril Paisley leaves his history grades to Francis Laven. Evelyn Colburn leaves her graceful dancing to her sister, Roberta. Lillian Frazier leaves her fiery temper to Norma McCormack. Tommy McNeil leaves his popularity to Bill Parke. Bob McTaggart leaves his way with women to any one who hasn't a way. Hortense Price leaves her basket-ball ability to Hal Smith. Margaret Stadig leaves her slenderness to Norma Hudson. Don Hall leaves his way with the woman to Melvin Howard, William Laven leaves his sophisticated airs to Bob Carson. Ivan Eckersly leaves his dancing ability to Gertrude Petersen. Katherine McNeil leaves her chemistry equations to La Gretta Hall. Wilbur Patchin leaves his cultivated speech to Marion Mintun. Albert Dumont leaves his best wishes to Miss Parks and Mrs. Boynton. Al Curler leaves-well, he just leaves--that's all. Francis Deane leaves his physics book to the future generations of T. H. S. Kenneth Clutter leaves conditions better after he leaves. Mildred Austin leaves her shorthand to Helen McMaster. The End Life Down life's lane we go togetherg We meet with storms and pleasure. lt is not all smiles and playg Sadness and sorrow come our way. Our loved ones come and partg And take with them our heart. We meet with joy and sorrow No one knows what comes tomorrow At the end of the winding path We reach the open gate. LILLIASI SMITH Page Thirty-one I TORRANCE HIGH SCHOOL Q Senior Alpha is for Arbclle, she holds a key to a heart But Willie doesn't care, he plays his part. is for Batsch, a fine young lady is she, But she can't be blamed that she fell for a is for Charles, who wears a red sweater, There isn't a senior who could be any bet ..g..5..g..x.., '..g..g..g..g..g..3..g..g..g,.g..g bet he. ICT. is for Dawson, who has red hair, No matter what she does, she always does it fair. is for everything in sight, Which we try to learn with all our might. is for Florence, so short and small, Her only wish is that she were tall. is for Granger, our class room teacher she is, And with the senior class she certainly is a whiz. is for Hinrnan, that's Bertha's last name, She likes to hear people talk and loves to do the same. is for I, meaning all of us, As seniors we always like to fuss. is for the juniors, we leave to take our place, We wish them luck and happiness in all they have to face. is for King, just another one of the seniors, We hope she doesn't spend much of her life is for Lola, who is a swell sport, All she needs is a tennis racquet and a court is for Mills, whom the seniors all like, working at a cleaner's. , And to the Hall of Fame she helped us hike, is for Nady, she's called Mary too, And with the boys she has nothing to do. is for Olga, just another blonde, Strange as it is, of blondes she is fond. is for Pal Marie, one of those innocent ones, She's just another senior, but sure knows h is for the questions we all ask, But the answering is surely a task. CI'0I1lOl'1S. Page Thirty-thr THE TORCH, NINETEEN THIRTY-TWO ,revel .L A. 1 .xggfg-. 1. -. .rnfnvnfnvnvnvnvnvnm 1. .vag1..snvnr:1nvLgv4L'Lv. Av- -1. in -v. wg- -1 4- - ,!,.i..x..x..x..z..y- Av- -'A 1- -1- -1. Av vv-f'x"x"x"5'-rv'r-4"s"r'v-s--ws-ww rr-rr. vs r wr v rr-rv-vw--wr-rvw.-'rv-4"5"5' --ra--rv's"x"4"4"x"x". is for Roelofs, whom everyone knows. And what will Torrance do after she goes? is for Sweeney, a football star so strong. For him, running SO yards is like a song. is for Thompson who could never be a charmer, He has his heart set on being a future farmer. means we understand everything now, But when vve're out of school we vvon't, somehow. is for Virginia, who has red hair, It makes no difference we guess, because Larry doesn't care. is for Wilhelm, she's as sweet as can be, Everyone loves her with her perfect personality. is for Xmas, that's when you can have a good time, This doesn't mean much, but the verses all rhyme. is for zeal, which we all need, But we try very hard and hope to succeed. Aulji jt iul n pn -p sp ! 1 , 0 Q .nllllllnnuunnmllll V V V rlmllhlllmlllv-Q ge Thirty-four ' TORRANCE HIGH SCHOOL ug,-Ng,3,viQLearn'HoggQJLQLQL'Legg'Java'LenqnenyggLfieafnvarnegoivavaeaogav..vLv:Qg4L'..z..xLrL . . . . vw- f f s r s rv-s--rs-'swrr: rv: www.-'s--rs we -4-'revs vw-w-'rf we 'c"r'o' fv- Class of S'33, W'34 First Semester Hazel Briney Ruth Nelson Mary Ogata Sophie Grasso Lillian Frazier Sophie Grasso Herman Hamman Bob Atchison John Hilpert Raymond Rogers Louie Briganti Vivian Young Rose Higgins Norma McCormack Bill Burkert Virginia Bowersox Russel Quigley "AJ You Like It" S 3 3 GIRLS Prerident Vice President Secretagf Trearurer Reporter Girly' League Kep. BOYS Prexident Vice President Xeeretag' Treasurer Sergeant-at-Arm: Reporter W 34 President Vice Prerident .Yeeretary Trearurer Girlr' League Rep Bayf' League Rep. Second Semester Mary Ogata Sophie Grasso Pauline Failla Aldine Brown Lillian Frazier Cecilia Ernst Herman Hamman john Hilpert Elmer Munson Elmer Munson Earl Doner Leo Sweeney Bill Parke Mae Guy Elsie Price Elsieaifrice LaPreal Hlifis Russell Quigley Pings Thirty Five Who's What in the Junior Class Winners of "Ts" THE TORCH, NIN ETEEN THIRTY-TWO I''ZnZ''I"2"!"Z"I+'Z''IME'-INZM2''E''2"E"E"M"!rfZ+wW+a'++Z"Ir6+r!+f!+rI'r5'-5"!eZeI+eI+Z+!r6+rI+r!f+Ire!e'frI+r!+4+eZ"Z"!"!"2"i"3"5"!"5"E"!"2- Junior Class History Five years ago we came into the fold of T. H. S., but three short years ago our class entered upon its high school career. After three years we have ninety-eight juniors, the largest junior class yet. This group, we believe, climbed more stairs than any other class. The junior class was the first and last to have separate home rooms for the boys and girls. This started way back in the 9th grade. The class advisers were Sig. Nylander and Mr. Andrews, but in the 9th grade Mr. Nylander took the boys and Mr. Andrews the girls. When Mr, Nylander left, Mrs. Young took the A-11 girls, Mr. Andrews the A-11 boys, and Mr. Mowry took the B-ll class. Our class has a number of members on the Scholarship Society list. Nor do we have weaklings in our class, for many of the athletes have been developed from our ranks. In fact, we might say that practically the whole football squad was composed of the good old junior class. In the junior year we presented the play "Take My Advice," by Elliot Lester. Mrs. Engel did an excellent piece of work as director. The production was a huge success, and if you "Took Our Advice" you probably knew that without being told. The Prom we gave the seniors was the first one, therefore, it was the nicest and most enjoyable ever given, and everything was beautifully arranged. We hope the seniors enjoyed it as much as we did. Pag World Friendship Ethel Sleppy Beryl Talent Gertrude Petersen john Hilpert Mary Ogata Lillian Frazier Cyril Paisley George Kubo Jean Tolson Scholarship ,jean Wheaton Beryl Talent Gertrude Petersen Jean Tolson Vivian Young George Kubo Forestry Club Jim McLean John Hilpert Melvin Howard Bob Carson Carl Quayle Bob Atchison e Thirty-six Key ciub john Hilpert Cyril Paisley Roy Farrell Bill Parke, Sec. Elmer Munson Myron Nightingale Robert Atchison Herman Hamman Future Farmers Carl Quayle Marion Mintun John Phillips Bob Carson Eldon Zanon Melvin Howard Junior Play Jim Lanz LaGretta Hall Elmer Munson Bill Parke Carl Quayle Ilene Falk Jean Wheaton Melvin Howard Football John Selby Raymond Rogers Bob Atchison Carl Quayle Francis Buchman jim McLean Herman Hamman, Capt. Russell Quigley George Figueredo Louie Briganti Varsity Club Carl Quayle Louie Briganti Raymond Rogers jim McLean Bob Atchison John Harris George Figueredo, Pm. Herman Hamman, Trmr Earl Doner Francis Buchman John Selby Eugene Walker TORRANCE HIGH SCHOOL +'L'2':'a9g'L'l':':':'a'a'g':!:':':'...! Y..9..!..'.J.Jg'h'..'..9..'..'.!:!:Q.. ':Y:I:Y..L.?..' !..?..'..Y..'..' ' Class of S '34 and W '35. "Marla Arlo About Nothing" AIO Sectionl Section II Section III Preyzdent James Lee Barbara Erickson Kiyoshi Minami Vzcr Pmidwr Charles Williams Horace Andrews Bill Denny Edith Riley Inez Smith Jean Kresse Tmzrurer Edith Riley Inez Smith Jean Kressc Clam Reporter Joy Possum Susumi Ishikawa Jean Kresse Sergeant at-Arm: Ruth Banks TOIIY Natale Boyr Athletic Rep. Ted Merrill MR. WRIGHT M155 VAUBEL Miss E. JONES First Semester B I0 Second Semester Thelma Lockhart Preridenr John Joyce Alfred Bunje Vice Pmidenr Ralph Kirchner Leila Combs .Verremq Virginia Barck Leila Combs TlBdJ1lfEf Dorothy McMillan Leila Combs Sergeant-ar-Amzr John Frasca Rachel Hudclleston T.N.T. Reporter Billy Acrce Mary Peckham Girlr' League Rep. Virginia Barck Albert Andre Bayr' League Rep. Billy Acree Mr. Burchett, Advirer SCHOLARSHIP Socm-I-Y MEMBERS: RACHEL HUDDLESTON, EUGENE STEGELMEYER. TENNIS ENTRANTS: DOROTHY MCMILLAN, BILL ACREE. BASKETBALL ENTRANT: MILAN MICANOVICH. P a g e T h i r t y THE TORCH, NINETEEN THIRTY-TWO f e'i'gl'Lv..5,,!,.5.,9JL'-ngavg4l'lvlvL'l!.Jl'l'a'ax,,!.,!,,! J- -laevlvg-Awislvgmrivufgs rx a r'r'r' we-.Y1--r-rr-rfr-r-f . r'r'r'o"r' -1--rw--rv-r-r-r'r-rr-r-r'rv' --wr' First Semester Hal Smith Jim Grubbs George Bradford Vivian Carroll Doris Taylor Martha Greaves John Hall First Semester Ruth Dawson Iris Rowe Raymond Tucker Raymond Tucker Goldie Higgins Nadine Sherwin Class of S'35-W'36 "A Comedy of Errors" A-9 Section One Prexident Vice Prexident Secretary Treaxurer Sergeant-at-Arm: Reporter Girly' League Rep. Boyr' League Rep. Miss Mabee, Adviser A-9 Section Two Preeident Vice Prexident .Yecretaqy Treanerer Sergeant-at-Arm: Reporter Girlx' League Rep. Boys' League Rep. Miss Willson, Adviser Second Semester Hal Smith Vee Kasper Olive Belle Huber Martha Greaves Jacqueline Rogers Emily Bechtel Martha Greaves Roger McGinnis Second Semester Garland Johnson Lorraine Roelofs Alice Fenneman Juanita Morris George Miura Nadine Sherwin Alice Fenneman George Miura HONOR Rom.: Henry Dossi. SCHOLARSHIP MEMBERS: Alice Fenneman, Ruth Granger. Page Thirty eight TORRANCE HIGH SCHOOL -iff-ffxiaalluu.-auuuuauuu.. .. .. ... .,.. .. .. .. .. ..+..furuv..Q..f..o..Q..f.. .- U -- H- 4'v'x"fr.'-rr. '- -- f- '-r-wrvw--vv-x".-w--rw--:vw--rv-s"rFr'rx'v'x'v'x"V"z First Semester Irma Herring Sidney Shelton Leona Keener Jacqueline Price Harry Richhart Jacqueline Price Sidney Shelton First Semester Merlin Cook Thalia Higgins Julia Smith Melvin Smith Peter Mason Marie Smith Truman Waugh B-9 Section One OfEters President Vice President Secretary Treasurer Sergeant-at-Arms Girls' League Rep. Boys' League Rep. Mr. Waddingham, Adviser B- 9 Section Two Olicers President Vice President Secretary Treasurer Sergeant-at-Arms Girls' League Rep. Boys' League Rep. Mr. Austin, Adviser TRACK ENTRANTs: Hubert Luck, Truman Waugh. HONOR ROLL: Aggie Lou Rippy. The Brook , .. 6.1-5?,F.f.T.TT WT T T Second Semester Takashi Kiyomura Hitoshi Hitado Betty Yost Jacqueline Price Harry Richhart Meryle McTaggart Sydney Shelton Second Semester Edith Sleppy Hubert Luck Melvin Smith Talmage Ulrich Peter Mason Mary McNeil Clifford Blackman The most beautiful spot is by a brook, When the birds are singing in the trees. And the trout dart from every nook, In the fall, when the trees wear crimson leaves. -ALBERT ANDRE, A-9 Page Thirty nine THE TORCH, NINETEEN THIRTY-TWO . .AA. S C. ,.A,.,,.A...,A,. i.a.a.L.n.n.n.i.a.a.,n n.,.a.,. wxwzwze-3-Qswswzmwmfmnf.-.tae .- .-was-an Class of S '36 and W '37. A-8 Section One First Semester Olicers Second Semester jane Johnston President John Connelly Ruth Barnard Vice President Edward Dussaman Laurella Lancaster .S'ecretaU Ellsworth Clark Ellsworth Clark Treasurer Fred Ralston Georgiana Humer Billy Atchison Girls' League Rep. Bays' League Rep. Miss Burnham, Adviser Eileen Miles Billy Atchison HONOR Rom.: Laurella Lancaster, Bettye Stevenson, Jane Johnston, Adeline Morisset, Ells Levy, Marie Gollands, Billy Atchison, Walter Bunje. A-8 Section Two First Semester . Officers Ina Mae Williams President Ray Steidel Vice President Jean Burger Secretary jean Burger Treasurer Victor Rose .Sergeant-at-Arms Marguerite Darling Girls' League Rep. First Semester Rosalie Brissinget Ruth Colbum Katherine Doner Robert Turner Lena Andrews Earl Clayton ge Forty Boys' League Rep. Mr. Thurman, Adviser Second Semester Jack Piper Victor Rose Ray Steidel Ray Steidel Muriel Gilbert Ina Mae Williams Ray Steidel A-8 Section Three Oilicers President Vice President Secretary Treasurer Girls' League Rep. Boys' League Rep. Mr. Fields, Adviser Second Semester Ruth Colburn Charles Smith Mary Francis Greaves Mary Francis Greaves Mary Francis Greaves Earl Clayton .3 x -N. x 4' . Y ff 'J xxvw l. K ,X V. f VY, :W , E , ,Q , 1 4 ,ef K xy, X AA 5 J gg, ,fig , f.. HQ 19+ V . 1 . Q , 'ht Q J If X, 19 ' ,2 'rg 4, 1 I 4 4 , L 1. A 3 if e W 2, R 1 L . 5 . 1 Mir' , V 1 V' A .ff ZL z, VA :'.'M. " , A jf - V W , f -I Lui' 1 J l -. ' if I' f f ljf H mfs.-A , THE TORCH, NINETEEN THIRTY-TWO -QJLQQLQL.. ,- -jafnerryn ,.a'afL,L,,QJa'..v.,,L,,Qa'..QL.L'xQr.,:L'.any Myer- - QA W 3:14, ,, ,,v .ua .L .- ,VW-4-. . .-wr.-. ef B-8 Section One First Semester Officers Christine Ingram Preyzdent Louis Everett Vice Prefiderzt Dorothy Leake Seeretay Dorothy Leake Trearurer Mary Jane Smith Girls' League Rep. Jack Monohan Bayer' League Rep. Mrs, Morse, Aduiyer HONOR ROLL: Dorothy Shaw, Jack Nonohan, Vida jones. B-8 Section TWO First Semester Officers Harry Lauver Prerident Richard Clutter Vice Prerident Mary Ortega Secretafy Geneva Andrews Treasurer Mary Ortega Girlr' League Rep. Harry Lauver Boyr' League Rep. Miss Summervvell, Aduirer Second Semester Clark Lowell Billy Ervin vida Jones Viva Jones Dorothy Shaw Jack Monohan Gertrude Movvry, Second Semester Harry Lauver Richard Clutter Toshi Nagayama Blossom Roque Blosson Roque Harry Lauver HONOR ROLL: Toshi Nagayama, Ermaline Shoptaugh, Mary Ortega. Page Fortv-O TORCH, NINETEEN THIRTY-TWO --L, --- LLLL,LLLLLLLLLLLLLLLLLLvLvLvLrLfLfL'L6LvLv,,v ..v..nv..' :W r-."r."rw--f'a- rr-4--t .ww--v we vw-rr-r .r rv1-vw-'rv-r-vw rv r--w-wr.-w--tr FFZT4'-FFF! 4' Class of S,38'W,39 First Semester Billy Keefer Paul Kasper Gerald Templeton Laura May Hyde Florence Buchman Robert Trezise First Semester Frank Lauver Margaret Doner Louis Madore Phyllis Haefeli Ethel Flvyd Clark Foster Prerident . Vice Prexident Secretary-Trearurer Girls' League Rep. Bayr' League Rep. gc Forty-Two A-7 Sect1on One Ofiicers Prerident Vice Prefident Secretary Trearurer Girlr' League Rep. Boyr' League Rep. Miss M. Jones, Advirer A-7 Sect1on Two Officers Prerident Vice Prefident Secretary Trearurer Girlr' League Rep. Boyr' League Rep. Miss Millerd, Aelvirer B-7 Second Semester Paul Kasper Bob Sleeth Florence Buchman Florence Buchman Dortha Joyce Robert Kincaid Second Semester Frank Lauver Margaret Doner Louis Madore Phyllis Haefeli Margaret Doner Robert Trezise Seislzi Yasunaga Mildred Higgins Dawson Stephens Korena Carlin . . . Tony Nady, Carlyle Bone Mr. Burk, Advirer TORRANCE HIGH SCHOOL - Q Qnfngnsnmq 1.Jnvnvne.1.4..'r.fJfnQnQ..'..Q..q..e..o..q.,e..q..,.,q.,f,,f,.o,4,4.J..qmfggfieavaer.QLQJJJLLhmhwafnemamemm, 'i"6"F-vw' rr "rwvw-FFFFr'r'rrVFFFFFQWWWWFFFFFFFF4e rw--vw-w-.fr-s-'ro-'r' " " " " " " " r'v'f'e '3' The Ephebian Society A California Organization Members in the Ephebian Society are chosen for their ability in scholarship, leadership, and citigship. One member is chosen for every forty members of a graduating class, or majority portion thereof, by the faculty and students. Keen in- terest centers about this choice. ' . 1922 Helen Neill 1928 Maxingrowi, 1923 None, class too small 1929 Richard Sinclair 1924 lone Barnett 1930 John Young 1925 Lucille Weaver 1931 Alfred Mintun 1926 Kathlyn Wheaton Mildred Holland 1927 Harry Phillips 1932 George Lancaster Lawrence Stevenson Self Government Board First Semester Officers Second Semester Ruth Wilhelm Prerident Le Roy Thompson Margery Roelofs Secretary Ruth Wilhelm Charles Montague Boys' Self Gevt. Charles Montague Pal Marie Henry Girls' S elf Govt. Pal Marie Henry Miss Elizabeth Parks, Adviser The duty of every Student Body ofhcer is to see that law and order are maintained in the school. Because of the work of the Student Body officers in the auditorium and in the hall, this obiect has been accomplished. Boys League President . .... . Bill Parke Vice President . Milton Everett Secretmjf-Trearurer . . Leo Sweeney Sergeant-at-Arm.: ...... George Figueredo The boy's league was reorganized last semester, So far it has proven a great suc- cess. The main purpose of the boy's league is to support interclass athletics, and to promote cooperation among the boys. At one of the meetings Mr. Fox, who is a supervisor of athletics, spoke to the boys on The Olympic games. A PageForty-Three THE TORCH, NINETEEN THIRTY-TWG '!"i'rM"I"E"I"!"Z"I-'ZMZNZMENENS'-E"5"I"E"!''E"I+s!+eH++?r?r5+eIe-E"!+I+I+ZneeirrgieinininlninlnininirrEfeZe4"'r'5"I"I+I+2"Z++f5-'Srl' First Semester George Lancaster Ruth Wilhelm . Dolores King . Pal Marie Henry Charles Montague Lawrence Stevenson Ethel Sleppy . Bill Lanz . Melvin Lockhart Jean Wheaton James McLean Margery Roelofs Bill Parke . Bertha Hinman Mary Nady . Student Body Council . . President . . Vice Prexident . . . . . Secretary . . . Prerident Girls' Self Government . . President Boys' Self Government . . . Stage Manager . . . Commisxioner of Finance . . Comfnirrioner of Atblefirx . Conzinifsioner of Oral Arr: . . . Advertising Manager . Store Manager . . Prerident Girls' League . . President Boys' League . . Editor of Annual Editor of T. N. T. Mr. Herbert S. Wood, Saperoiror Second Semester Thomas McNeil LeRoy Thompson . Rose Higgins Pal Marie Henry Charles Montague Lawrence Stevenson . Ethel Sleppy . Bill Lanz . Bill Parke Arthur Yamamoto . Mary Nady Ruth Wilhelm . Bill Parke Bertha Hinman Margery Roelofs The duty of the Student Body Council is to govern the school in the best possible way. This work is not forced by the faculty, but it is the direct expres- sion of the students of Torrance High School. One of the most important duties of the Council is to appropriate funds to be used for school needs of all kinds. Girls' League First Semester Othcers Second Semester Margery Roelofs President Ruth Wilhelm Mary Whalin Vice Prefident Ethel Sleppy Mary Nady Secretary Jean Wheaton Ethel SICPPY Treayurer Dorothy Stevenson Ruth Barnard Sergeant-at-Arm: Ruth Barnard Junior High Honor Roll The Honor Roll is composed of junior High students who have a certain amount of A's and B's. MEMBERS B8 Toshi Nagayama, Mary Ortega, Ermaline Shoptaugh. A8 Marie Gallands, Jane Johnston, Laurella Lancaster, Ella Levy, Adeline Morisset, Bettye Stevenson Ina Mae Williams, Aggie Lou Rippy. Page Forty-Fou B9 I' TORRANCE HIGH SCHOOL Jgfxrxvawgvxv, .z..e..v. .vava'gL'LfA .vavafavQ:rQava'avL'g- -ggvdgggrxv. .r. agar. .QA .ravavJag'Ja'avJa'J+'4Q'+:QQ 'wr . rrw--a--c"r'r-s"rr-rv-rw'-. 1''wrvw-ufvvv'v-rf: rv-rv-r-r'4"f wPx".w f wr rv www 1' . . . 4 . . r' Above, Student Body Councilg Below. Girls League Pa l ge Forty-Fiv THE TORCH, NINETEE N THIRTY-TWO 'IwieZelfleleieieleieieieieiHAIH+!HQFkeieleieieieieleieieieie264+H+?!eI+I+If!e!eIe!e!ee?eI++Z++!+!+I+Z'IHFGIWZQ+6162 Above, Modes in Mannersg Below, Scholarship Society Page Forty-six TORRANCE HIGH SCHOOL . g fgagagagagw- -'mb -f,..,- -fm -Qggigagagggggagagggagggaga',.,A em- "gga,a,a,agggag..5. Modes in Manners Preridmt Pal Marie Henry Vice Prerident Margery Roelofs Sccretagr Jean Wheaton Treasurer Blanche Lukes Miss Willson, Advirer Although the Modes in Manners Club has done no active work for the school, the members have learned much about Ways to improve themselves in dress and manners. A lunchon was held for Cassinova Hailey, the only member to graduate with the Winter '31 class. The annual reception for the summer graduation class Was also an attractive social function. MEMBERS Elizabeth Burdick, Alice Burger, Cassinova Hailey, Pal Marie Henry, Dolores King, Marguerite Lincoln, Melvin Lockhart, Blanche Lukes, Dorothy Myers, Mary Nady, Cleta Neville, Margery Roelofs, Jean Wheaton, Ruth Wilhelm, Vivian Young. Scholarship Society First Semester Officer: Second Semester Marguerite Lincoln Preridenr Bertha Hinman Beryl Talent Vice Pferident Joy Fossum Alice Dossi Secremfy Alice Burger Alice Dossi Tmzrurer jean Tolson Miss Mills, Adrirer Life members of Chapter 121 Torrance High School Scholarship Federation are: 1926 Flossie Smith, Kathlyn Wheaton. 1927 Toshi Kiyomura, Allen Musselvvhite, Harry Philips, Ruth Lingenfelter. 1928 Tatsuo Inouye, Doris Spoon, Margaret Tiffany. 1930 Edna Richhart, Beulah Cooper, john Young, Margaret Richhart. 1931 Frances Granger, May Haslarn. " 1932 Margery Roelofs. MEMBERS Alice Burger, Alice Dossi, Lendel Elder, Joy Fossum, Rachel Hudclleston, George Kubo, Marguerite Lincoln, Cleo Long, Robert Nourse, Gertrude Peterson, Eugene Stegelmeyer, Beryl Talent, jean Tolson, Jean Wheaton, Jean Crawford, Alice Fenneman, Bertha Hinrnan, Dolores King, Verna May Long, james Miller, Cleta Neville, Ula Paisley, Margery Roelofs, Jean Solomon, Ruth Wilhelm, Vivian Young. Page Forty-Seven THE TORCH, NIN ETEEN THIRTY-TWO ti'ries?WhsZ+r!+e2e!HIe4+r!+eZrrZeZeI+I+I+Z+K+!efnlplnieisriteEffieInInIHI+!eInInIpInI+I+X+!eIn!fZ+I+I4IeInI+?r!p!n?w'+IeIrie?Z' V ars1ty Club First semester Officers Second Semester George Figueredo President George Figueredo Elmer Riley Vice Preeidenr LeRoy Thompson Carl Quayle Secretary jack Christenson James McLean Treasurer Herman Hamman Louis Briganti Sergeant-at-Arm: V Elmer Riley Reporter Lendel Elder Coach Fields, Director The Varsity Club has worked very smoothly under the leadership of George Fi ueredo and Coach Fields. A ve successful ban uet was s onsored b the club in S YY ll P Y January. M E M B E R 5 Bob Atchison, Louis Briganti, Francis Buchman, Jack Christenson, Ivau Eckersly, Lendel Elder, Milton Everett, George Figueredo, Herman Hamman, Bill Lanz, james McLean,John Mock, Carl Quayle, Elmer Riley, Raymond Rogers, john Selby, Lawrence Stevenson, Leo Sweeney, LeRoy Thompson, Eugene Walker, Pete Zarnperini. Key Club Lawrence Stevenson President Charles Montague Charles Montague Vice President Lendel Elder Lendel Elder Secremy Bill Parke Stanley Sach Treafurer Bill Loftus There are two main purposes of the Key Club. One of these is to help the members decide which profession or trade they wish to follow. They are helped to do this by having business men speak to them on different types of work. The other purpose of the club is to create high ideals of sportsmanship and citizenship. This is made possible by having a general discussion on subjects per- taining to these. I The funds of the club are enlarged by fming the members for certain acts of misbehavior. This is always accompanied by a great deal of amusement. MEMBERS' George Bradford, Kenneth Clutter, Hartley Cooke, Lendel Elder, Roy Farrell, Kenneth Fess, Kenneth Haslam, Ross Hatton, John Hilpert, Dale Howe, William Loftus, Charles Montague, Francis Mowry, Robert Nourse, Cyril Paisley, Bill Parke, Stanley Sach, Lawrence Stevenson, Pete Zamperini, Bob Atchison, Herman Hamman, Myron Nightengale. Page Forty-eight - TORRANCE HIGH SCHOOL .v..r..o,.r:o:q2Q:e2yLe, v,,nav,.v,.Q:o..p ,w,,o,,o,.o..n,.v,Ay ,v ,e,.v..v..v,.y..Q,.v,.v: v, on- Q. vw, ,Q 1 Q..rf1J 4'l':f:'Q'a'a H' -' , -www.--.--.--.Y-.--.Y rv-.V .-.-.- 4Trwffrr.-F.ffw-vwvvwff.-. Eff:-rv-w-vv'!"."i"Se+.-'.'w". '!"!"!--.--.- .--.- . . Bw-. 3 Above, Varsity Clubg Below, Key Club Page Forty-Nine TORRANCE HIGH SCHOOL Above, Quien Sabeg Below, Inter Nos a g e F i 1 t y TORRANCE HIGH SCHOOL -v--ggmaaandnvavnvnvmnva - ,.r..f.4.3..e..a..f..,,,Q..f,.,..,..,,.',,f..f..f.,v,,Q,,g,,y,,'..v.. .,...gM,n,,,. . i ew. . . .f.f.f.f.f.T.f.f.e.f.f.e.f.f.T.Y'.--.f.f.f:a'-zf.f.-were 5 uien Sabe? First Semester Oliicers Second Semester Van Bartechko Preridem' Marguerite Lincoln' Margery Roelofs Vice President Audree Rocque Marguerite Lincoln Secretary Ruth Nahmens Mary Nady Treasurer Arthur Yamamoto Florence Gramliug Reporter Mary Nady Mrs. Boynton, Mr. Wright, Sponeerx M E M B E K S Van Bartechko, jean Crawford, Sr,, Alice Dsssi, Florence Gramling, Dolores King, Marguerite Lincoln, Willian Loftus, Fred Marsteller, Robert MeTaggart, Wilbur Patchin, Charles Montague, Mary Nady, Shizulro Nagayama, Ruth Nahmens, Edith Riley, Audree Rocquc, Margery Roelofs, Virginia Turner, Arthur Yamamoto, America Hadler, Dorothy Gramling, Mary Peckham, Alfred Bunje, Eugene Stegel- mcyer, Barbara Nickerson, Lorraine Roelofs, John Frasca, Cecil Bishop, Elizabeth Neelands, Millicent Lincoln, Floyd Williams. Inter Nos First Semester Oilicers Second Semester jean Wheaton Prerident Lillian Frazier Lillian Frazier Vice-President Joy Fossum Vivian Young Secretary Esther Terry Elmer Munson Trearurer Myron Nightingale Helen Smith Reporter Helen Smith Mrs. Morse, Spomar The Latin Club of Torrance High School has had a rapid growth. Much has been accomplished during the past year. The meetings have been most interesting. Talks were given on ancient Ro- man life and customs, books, which give the best information on this subject, were discussed. Upon the suggestion of the sponsor, Mrs. Morse, the Club has decided to purchasea statue of the "Victory of Samothi-ace" for the club room. The Annual Roman Banquet was held in the spring. The Latin Club is indeed an organization of which Torrance High School can bc proud. The motto of the club is "Non Scholae sed Vitae Discimus" which means "we learn not for school but for life." For the Christmas meeting a party was given in the cafeteria where games were played and refreshments were served. M E M B E R 5' Alice Burger, Francis Carnahan, Vivian Carroll, Margaret Condon, Elizabeth Edwards, Irene Fix, joy Fossum, Ruth Granger, LaVern Jones, Margaret Kibbe, George Lancaster, Roger McGinnis, Myron Nightingalehlacqueline Rogers, Helen Smith,Jean Solomon, Esther Terry, Bob Wertz, Mary Whalen, Fern Wright, Vivian Young. Page Fifty-one THE TORCH, NINETEEN THIRTY-TWO . , ..v..v, Que .v..o..v..e..r..q..o..v noyvvoooeneoogyyv eovseq YYY,7777,,,,::2l44,4almmi:L2514nmLgggfif--'L'QL'YY29:'2'aiYY ' " ' " ' 4' r-vw' s rw va -ra s r'rr'r-rw"v r- -'rv-4-'r we--r'a-'rw--4 vw' 4-'rw-'s--a"s"fw .H ' ' First Semester James McLean Betty Danford Margaret Floyd Willard Barnett Richard Colburn Betty Danford George Kubo Leonard Lock Jack McCune Wilma Motika Dorothy Myers Student Body Store Manager Stock Manager Candy Manager Clerkr Miss M. Jones, Supervisor Second Semester Mary Nady Ruth Wilhelm Mary Nady Blanche Lukes Mary Nady Elmer Riley Eugene Walker Richard Watson Ruth Wilhelm Pete Zamperini Ruby Avoian Richard Watson Jack McCune Kathryn Baker Few people realize how important the Student Body Store is. The purpose of the store is to increase the funds of the school, and it is the duty of each student to patronize it so that there may be money enough in the school funds to provide for it's needs. World Friendship First Semester Officers Second Semester Van Bartechko Preridenl Arthur Yamamoto Elmer Riley Vice Prerident Margery Roelofs Cleta Neville Hirtorian Isabelle Burdick Blanche Lukes Reporter Bernice Baker Arthur Yamamoto Treararer Stanley Sach Isabelle Burdick Seereragf Viola Dawson Mrs. Granger, Aduirer At each meeting of the Club an interesting speaker is presented. This year the speakers were: Bertha I-Iinman, Isabel Burdick, Miss Eva Jones, Mrs. Conklin, four boys from the Spanish-American Institute, Wanda Stackovvitz, and Mrs. Winkler. A bird portfolio was sent to a sick boy in Massachusetts, and plans are under Way for two portfolios to be sent to foreign countries. Some beautiful boxes were received from Japan in return for the box sent last year. The correspondence with boys and girls in Holland is proving a great success. M E M B E R S Mildred Austin, Bernice Baker, Willard Barnett, Van Bartechko, Elizabeth Burdick, Isabelle Burdick, Francis Carnahan, Jack Christenson, Hartley Cooke, Viola Dawson, Lendel Elder, Raymond Farrell, Lillian Frazier, Stanley Gilbert, Bertha Hinman, Florence Gramling, Genevieve Guyan, Donald Hall, Georgie Higgins, John Hilpert, Delores King, George Kubo, Marguerite Lincoln, Melvin Lockhart, Blanche Lukes, Bob McTaggart, Florance Merriam, Charles Montague, Mary Nady, Cleta Neville, Myron Nightingale, Robert Nourse, Mary Ogata, Cyril Paisley, Gertrude Peterson, Elmer Riley, Margery Roelofs, Stanlye Sach, Warren Sapp, Ethel Sleppy, Lawrence Stevenson, Beryl Talent, Gene Tolson, Virginia Turner, Arthur Yamamoto, Vivian Young, Pete Zamperini, Eldon Zanon. Page Fifty-two T'CJR R A,N CIS H IG-H SIIPICJCDL -.i.L.l.,.,,,.a.a.a.a.a.a.L.l.-.J,.,,,.,.,.A.a.a.a.i.a.,., 2 2.4.4QL,.,.,L.,.4.:,Y.L.,.l.,.L.a.i.Q.+.a.5.g.L -sw .".-Tv.--.--4--.V .nf .'f.'f.''.'-fy.--.--.-Y.--.V . . .7f.v'.'f.H.'-.-V.-T-.V'.--.--.'-.--.-'.-'.--.--.-'.-'.--.-'.--.-'.-'.-V.-Y.-'.'f.H.' .Y .W .W .V Above, Student Body Storeg Below, World Friendship Club Page Fifty -:hr THE TORCH, NINETEEN THIRTY-TWO , ll, ish.-,nineQ-f,,,n,..v..Q,,yLv,', :,:f,,vnf..',.vA'43,-:fnfnfnynvavaeigfnqnfnynv.,JJ :Q:,gy.rfn,nf..,,JJ-.421 f, ."5"r. f .--wrt'vw--x"x"x"r-r'r-x"f"f"2"f--r-rv'x'v'v1 www-'r-rv-ru .www--r-4-v':"z". 'F'z"r'v""c"r'X"X'W' s r- WW Annual Staff l Bertha Hinman ..... . . Editor Jean Crawford . Associate Editor Robert Nourse .,.... . . Business Manager Florence Merriam ...... . Advertising Manager Cecil Bishop, Eugene Stegelmeyer, Alfred Bunje . Assistant Adv. Manager Dolores King, Marie Batsch, Olga Jaunsem . . . Alma Mater Ruth Wilhelm, Florence Gramling . . Activities john Selby, Elmer Munson Mary Nady . . Cleta Neville David Clark Marie Belasco . Elizabeth Burdick . Mary Ogata . Alice Burger . . Jessie Mae McCray, Lucille Ethel Sleppy . . Miss Ada Chase . . Mr. Herbert B. Andrews . Miss Ethel Burnham . Miss Jessie Weaver Miss Sara Vaubel . Page Fifty-four Thompson, -lean Hudson. Boys' Sports Girls' Sports . Calendar . Snaps Humor Faculty . Art Editor Subscriptions . Typists . . Bookkeeper . Art Supervisor Printing Supervisor . Faculty Adviser . . . Auditor Advertising Supervisor TORRANCE HIGH SCHOOL -'7',',97Y7',9,'L9:'2YJ'b -Y.JL'l9L':YLQYJYLVQLQL'gfgfifx9:92Y:92Y:':9:':':YiY:9:Y:!:Y2!i'f'T'f'e'e'a'a'- -:wx-U4 1 fvwwfvvva.wvfvvvvwafffvvvvvf.f1f.fafvvw.a1v........r . Torrance News Torch Mary Nady Editor in Chief Margery Roelofs Margery Roelofs Associate Editor Charles Montague Wilson Page Boys' Sport Editor Bill Loftus Florence Gramling Girls' Sport Editor RuthWilhelm Florence Merriam Junior High Editor Florence Gramling Stanley Sach joke Editor Marie Belasco Marie Belasco Exchange Editor Florence Merriam Warren Sapp Business and Advertising Lillian Frazier Olga .Iaunsem Circulating Manager Arbelle Kirchner Margery Roelofs Proof and Copy Reader Bernice Baker Torrance Herald Reporter Jean Crawford Kenneth Clutter, Grace Denney, Arthur Yamamoto Reporters Edith P. Kelly Journalism Instructor Herbert Andrews Printing Instructor Jessie Weaver Commercial Dept. The T.N.T. was increased from a four-page paper to a six-page paper, which was distributed weekly. Because of the hard labor and efforts of the business and advertising manager, Warren Sapp, the paper was distributed free to all students and faculty members. PageFi fty-Five THE TORCH, NINETEEN THIRTY-TWO ,z efeqgefgiffexfgfgifxfifxfgxqav,1,.,Jig.JLQJLfa.av,f,v:f:'JLoa'JJAQQLQJQJQ,,f ,'L'a.,',':f:,:fQJ,., 4 Q 5 vw--vw vw rv rw. vw F4'1'w-w--vw--rw-v-.-'rv rv r-rw--wr'.-w-v.' 4--v-v'x'n--rr rv f . 'rs-w--r Above, Beaux Artsg Below, G.A.A. gc Fifty -six TORRANCE HIGH SCHOOL J get,'JAvMx.:A'ggifnfa9gfAQ..x..9Avavga'AvAfavnvhs..e..e.4..o..Q..Q..Que.Q..Q..,..g..4..,., ..w..v..f..Qn:nQ..y.ivannQnf..y..g,,,,, -, s"5"5"2 4 fa -rw--rvw--r.- rv ra-v'rs-v-.--rr-rw-'vwe'FFFFFFFFFFFFFFFf"!fFFPx-er-v-vw rv-4'v'x--wx". Girls' Athletic Association Jean Wheaton Prerident LaGretta Hall Alice Gall Vice President Marie Batsch Rose Agapito Secretnga Rose Higgins Mae Guy Trearurer Aldine Brown Hendr of Sports Ruth Wilhelm Bnrketball Lillian Frazier Speedbdll Lola Cokely Tennir Lola Cokely Hoekq Trixie Rowell Bareball Eleanor Austin The G.A.A. is an organization composed of girls who have earned one hundred points in competitive sports. Their meetings are held on Monday twice a month. Each semester the girls are allowed to attend one playday at another school, and give one here. Girls who have earned five hundred points are given a letter, and for addition- al points stars are given. A banquet is given each year, at which the girls receive their awards. The sponsor of the G.A.A. is Miss Klein, girls' physical education instructor. La Soceite de Beaux Arts Officers President . Viola Dawson Vice Prerident Patrira Carlin Secretary-Trenrnrer . . . . Margart Condon MEMBERS Emily Bechtel, Aldine Brown, Norma Buckler, Patricia Carlin, Vivian Carroll, David Clark, Evelyn Colburn, Roberta Colburn, Margaret Condon, Viola Dawson, Elizabeth Edwards, Ruth Granger, joy Heglie, Margaret Kibbe, janit Masrai, Roger McGinnis, Una Jean Peterson, Beatrice Riley, Jacqueline Rogers, Nadine Sherwin, Adeline Shoptaugh, Theresa Tucker, Raymond Tucker, Dorothy McMillan, Mary Peckham. Page Fifty-seven v!a'a'a THE TORCH NINETEEN THIRTY-TWO 3 Zee!-TWINS"'rr?r2++!+IrIrieieir?Zf!s'!nZe!e!rIe!eZf!fIrIfInInieIr!EIrlrfefiriflrirfffiririrififir3reZr2rZrI"Zrr2r+!"'r'Z Science Club i Row 1: Rowell, Hilpert, Patchin, Bunje, Frasca, Rogers. Row 2: Nourse, Bruhanski, McNeil, Mock, Stevenson, Mowry, Long, Lanz. Row 3: Christenson, McLean, Sweeney, Waddingham, Bishop, Mendenhall, Wood, Hippik, Miller. Q Q ...ui- . rr' First semester Oliicers Second Semester James McLean President LeRoyVThompson Robert Nourse Vice President Robert Nourse Leo Sweeney Secretary Leo Sweeney John Mock Treasurer John Mock John Hilpert Sergeant-at-Arms James McLean Elmer Riley Reporter Jack Christensen The object of the Science Club is to create an interest in scientific progress, and to call to the attention of the members some of the things happening in the scientific world. Some of the men who spoke before the science club were Dr. Lancaster, and R. K. Floyde, Vice Principal of Inglewood High School. M E M B E R .S' Thomas McNeil, LeRoy Thompson, Carroll Bender, Lawrence Stevenson, Elmer Riley, John Hilpert, James Miller, Paul Hippik, Robert Nourse, LaVern Jones, Thomas Rogers, Cleo Long, Melvin Howard, Guy Rowell, James McLean, Jack Christensen, Henry Bruhanski, Stanley Gilbert, Wendell Leatherman, john Mock, Leo Sweeney, Ivan Eckersly, Francis Mowry, Raymond Schumacker, Dale Howe, Wilbur Patchin, David Amlin, Edwin Wood, Billy Merriam, Charles Kennedy. Stage Crew Row 1: Bunie, Bradford, Mowry, Cook, Sach, Stegelmeyer. Row 2: Burchett, Nourse, McGinnis, Stevenson, Gilbert, Burk. The stage crew sets the stage for all aud calls, the senior play, the junior play, and other school or outside performances that use the stage. There is at least one member in attendance at each to operate curtains or lights. When there are any changes to be made, more of the crew are on duty. The work done by the stage crew for the Annual Benefit program and the combination World Friendship and Beauty Lovers' Club meeting are examples of short time changes. The stage crew has done good work this year in spite of the difficulties caused by teaching new members to take the places of the experienced members. The experienced members are Lawrence Stevenson, 7 semesters, Robert Nourse, 6 semesters, Hartley Cooke,,6 semesters, Stanley Gilbert, 4 semesters, Stanley Sach, 4 semesters, all of whom are graduating. M E M B E R .Y Lawrence Stevenson, Manager, Robert Nourse, Eleerrieianf Hartley Cooke, Stanley Sach, Stanley Gilbert, Crewp Francis Mowry, Eugene Stegelmeyer, Alfred Bunje, Max Briney, Electrician belpm-,' George Bradford, Roger McGinnis, Crew helperr. Page Fifty-eight THE TORCH, NINETEEN THIRTY-TWO ,, e..g,v,.v v..v.,v..vaeav .1 14, qufufu A, ,JM ,A JM ,A M. ,, ,A , ,M ,A ,M ,A M A Q Q-fa,,Q,,viow Evra 4-r'5+f!+eE".'vv'.' .v-r-rr-ri'-E"ie+Z+e'reIf'i"!"f"ev'ri-iw4'-Z'Z'4-2'-?-2'-r'I-If?'I-iflfififl-I-I-4"2".".V-.- . . . . S' Above, Science Clubg Below, Stage Crew P age: Fifty -Nine THE TORCH, NINETEEN THIRTY-TWO -,,r.,z,.x,,5,,5,,Z,a5a,.iviwi,:,. .f. .q. .,, .QJJ-Jxfxfxfir. .f. .v. .L Add. .v. .Q. .vxfxfxvan .'. .QAQJJJJ . .,..,. .f. J. .f. .f. .'. .'. .'. . . . . .w-'wr-4"4"4"x".' www--vw-'r'x"f'4"x".' 4' 4"4"x"x"r-rw .vm .ww ffIf'ffFFFFa"r.-F.- x" Above, Agriculture Clubsg Below, Agriculture Teamsg Page Sixty THE TORCH, NINETEEN THIRTY-TWO Ju! --Q.-O.. ..Q29AQ,.v,.Q..9..y..f ,,Q..q.,v..v,.Q ,,r..Q..Q,.e ..f..v..Q.J.A,4..o,.y..f,.9..v..v,.Q,.9..v..f,.Q..9..Q..f..t..v..!i 9 0 - f"f"!'QVf"s"f"f"v 's' '.refs".'afcfefeezwsrsfafifsftffzfrrweef7x"s'.f4'sfx"xfaT4"s"X"vFaf6"+"xfaf4'4?4?r'zTs' '2":"!"!"4"f".":' Motif of T.H.S. Torch for 1931 The motif chosen this year is that of the drama. Our book is divided into five Parts, which we have designated as acts. These parts are introduced by Colored division sheets, each bearing a design of a mask, that being a commonly accepted symbol of the drama. An innovation is the use of the linoleum cut in our decorative work. The decocation on the title page, and the finis, were designed and cut on blocks by Mary Ogata. Other designs selected Qby vote of the art Classesj were as follows: Act 1: Ruth Wilhelm Act 2: Elizabeth Neelands Act 3: Ross Hatton Act 4: George Miura Act 5: Nadine Sherwin The color scheme of the book and other details of its makeup were planned by Mary Ogata, who acted as Art Editor. The cover is from a design by Pal Marie Henry. Natinnal Srhnltwtir Hreaa Aaantiatinn 1951 ALL-AMERICAN YEARBOOK CRITICAL SERVICE ' y Mrk I at f WT O THE TORCH I In recognition of its merit., is awarded jfirft Qlllztss Zlaunnr Rating in tlie Eleventh National Yearlyoolt Clriticai Service of the N ational Scltolastrc Press Association at.: the University of Minnesota, Department of Journalisln, tlulv First Clay of October, 1951. A H PFW' Y omttf...-1 -1 nu-i. fzladv llhl-lrlnl flprthl ' lm sun . Emu,-1 Ima um- - - mm an :uw ilan A-my ' I-da nm in Inn- Page Sixty- THE TORCH, NINETEEN THIRTY-TWO ..o,.Q.,4 Q4 o.Q..e,,o v..e.rn..Q 0.4.4 .env ,v..e,.s. .vue . nf,4,..,,'..',.,..'..'..f,,v,.emi .lo..mvmnm.-v -'mfg v f"f'v'ximi--rw--Qiifr. i"rvw--w --r'x"x n rc' -w 1--r'x"a' 'viii' -r-FFQW-1 Ffti--r -smffvwxv Agriculture Teams Stock Judging A Team Ted Merrill Melvin Howard Marion Mintun Bob Carson Dairy Products A Team Thomas Mc Neil Dale Howe Kenneth Fess Carl Paxman Stanley Sach Martin Kalina Dairy Cattle A Team Kenneth Fess Cornelius Peet Carl Paxman Dale Howe Plant Identification A team Sydney Nickerson Kenneth Fess Marion Mintun John Phillips Citrus Judging Teams A team Thomas Mc Neil Kenneth Fess Dale Howe B team Beulah Russell Mildred Cowan Eleanor Austin Francis Mowry The Citrus Teams walked away with all honors in the Los Angeles City Finals. Kenneth Fess was second high individual of the contest and Thomas McNeil was the high individual of the contest. The A team has won the cup for three successive years, so the trophy is now in their permanent possession. They then went to the National Orange Show where the A team won first honors and the state champion- ship. Rain Rain splashing and tearing in long silvery streams, now Stinging and swift, blown in gusts by the cruel wailing wind. Raindrops now falling softly like low murmuring armies, Hushed and spent from the long hours of fury. Page Sixty-A BARBARA N ICKERSON, A-9 TORRANCE HIGH SCHOOL !.J..Q0l!..!.J.. ..!..!..Q,. ..Q..!,.!..Q,.!..Y..Q.. ..Q.,Q..0..9..0 .LAND ,Q..9.,!..!..Q.J..Q,.9..Q..!.,!..9.,!..!,.0..'..V..Q..f.. ,,Q..9,.Q,.' LYMYMMLM' -.wW:ezezf.f.f.f f.f.f.f.f.f.e.fse:?F.f.f.f.f.f.f.f.f.f.e.f.fF.ff.f.f.f.f.f.f.f.f.f.ve.e.f.f.ez, -W at S. Future Farmers' Association First Semester Officers Second Semester LeRoy Thompson President Stanley Sach Ted Merrill Vice President Cornelius Peet Sydney Nickerson .Yeeretiirj Sydney Nickerson Melvin Howard Treasurer Thomas McNeil Kenneth Fess ' Reporter Hartley Cooke The Future Farmers Association is a nation-wide organization, they hold an annual convention. The last con vention met at the Alexandria Hotel, Los Angeles. The host for the evening was Governor Rolph. M E M B E R .Y Melvin Howard, Sydney Nickerson, Dale Howe, Cornelius Peet, Ted Merrill, Kenneth Fess, Stanley Sach, Hartley Cooke, Marion Mintun, Francis Mowry, Carl Paxman, Bob Carson, LeRoy Thompson, Thomas McNeil. Forestry Club First Semester Ofiicers Second Semester Ted Merrill President Stanley Sach Bob Carson Vice Prerident Bob Carson James McLean Secretary Stanley Gilbert Mr. Merrill, Advirer The Forestry Club has a new stucco club house at Clear Creek in the Arroyo Seco mountains. M E M B E R S Stanley Sach, LeRoy Thompson, Herman Hamman, James McLean, John Hilpert, Bill Lanz, Melvin Howard, Ted Merrill, Carl Quayle, Kenneth Fess,James Lanz, Guy Rowell, Elmer Munson, Cornelius Peet, Bob Carson, Thomas McNeil. 'W Agriculture Club First Semester Officers Second Semester Sidney Nickerson Prerident Thomas McNeil Ted Merrill Vice Preridenl Stanley Sach Cornelius Peet Secretary Cornelius Peet Treasurer Trixie Rowell Reporter The Aggie Club has a new type of letter, the members will be known also by the chevrons that are worn on the sleeve, a new feature in the high school. M E M B E R S Jean Wheaton, Beryl Talent, Melvin Howard, jean Roberts, Cornelius Peet, Ted Merrill, Dale Howe, Kenneth Fess, Dorothy McMillan, Rachel Huddleston, Bob Carson, Sidney Nickerson, Trixie Rowell, Stanley Sach, Melvin Howard, Sam Smith, Hartley Cooke, Marion Mintun, john Phillips, Carl Paxman Eleanor Austin, Francis Mowry, Mildred Cowan, and Thomas McNeil. Page Sixty-one THE TORCH, NINETEEN THIRTY-TWO TTTTTTcwoycfofsfsff-"X"X'a'eFsmysmarty-maysf.'.'.f.f.fsTsysT4TsysfsysfsTs''r's-'s-'a--rw'vc-uw rv' -' -' " " " " " " Anne jones . Mildred Ellis Mrs. Jones . A Plumber . Another Plumber Henry Jones Wilber Jones Billy Morgan Katie , . Diana Devereaux Stanley jackson Mr. Silverberg Policeman . Senior Play HJONESYH Presented by Senior Class November 20, 1931. CAST OF CHARACTERS' Margery Roelofs Marguerite Lincoln Ruth Wilhelm Norman Barck . Jacob Gall George Lancaster Edward Hartwell . Lendel Elder . Mary Nady Melvin Lockhart Van Bartechko . Warren Sapp . Elmer Riley Mrs. Engel, Coach ' Witty lines, clever acting, and the up-to-date plot, made the Senior play "Jonesy" a success. The action of the la centered about the oun bo ones , who came home I Y 'Y g Y Y. 1 from college and fell in love with an actress, Diana Devereaux. With his father and mother intervening, a very complex situation arose, but in the end everything was settled to the satisfaction of everyone. Junior Play "TAKE MY ADVICE" An American Comedy in three acts Presented by Junior Class March 18, 1932. CAST 0F CHARACTERS Bud Weaver . Ann Weaver Jim Thayer . Kerry Van Kind Joseph Weaver Mrs. Weaver Bradley Clement Marella Acotte Melvin Howard LaGretta Hall Elmer Munson . Jim Lanz . Bill Parke Jean Wheaton . Carl Quayle . Ilene Falk The junior Play given March 18th. It involved a situation of American home life of comedy and mystery. The juniors proved to be successful actors and there will be no doubt a great deal of talent for their Senior play. Mrs. Engel directed the cast, and the juniors in the cast extend their appreciation and thanks to Mrs. Engel for her fine directorship. Page Sixty-two LFORRANCE HIGH SCHOOL - f LLQJQQQ LQJLQQQ. f Lf ML. . - f . LQJJY. . . f 1,2120 Q f . v. 'JJ f - ,. .Y.,,.,,,,,,,,v.,.M . Q., .H-, v-rw.-X. . YI". . . . fr. . . . . .-ww. . . . .-'.f.'.'. . . .v.f. . . . . .frf.f.f. . . . . . . . . E". . Cast of the Senior Play Cast of che junior Play gc Sixty three THE TORCH, NINETEEN TI-IIRTY-TWO - - v , , ..,,.',,L'44,'JYv,vY,Y'JJ,fJ,Mfg.,Q,LLLQ-0-Lv,'JYLLL'YL.YL.JY.JYfJYvYf . ,. ,,.,,.,,M. A .Nm . ri-vw-Y. . . . . . . . . . .f .vf.ff.ff.-1' .f .f .f . . . . . . . . . -nww-w-vww-w--rw-vw.-'w."! v'Z"!"!"I . . . H 7 Above, Schumann Societyg Below, Madrigal Society Page Sixty-four 7 TORRANCE HIGH SCHOOL .!.J:'a0aLLn.. .. .. .. t. no.. ,v,',.. .W TTTTTWT vLt..x..x..ie..x..2..x..sLfL1LQ..x..x..x..x..rLvLo .L.f..Q..Q..f..e..Q..Q..Q,.f..9..o..Q.,Q..y v w- -r w- -r -v -v -r 1 v v v w 1- -4- -r -v -v -FaWTF:fafafsfefsfmfauafsf Schumann Society Prerident ' Van Bartechko Vice Prerident Elmer Munson Secretary and Treararer Mary Nady The Shumann Society is interested in knowing more about musical affairs in our part of the state, and also in a wider acquaintance with the world's best music literature and its great composers. Discussions of musical events and facts about music fill the meetings of this club. MEMBERS Van Bartechko, Isabelle Burdick, Lillian Frazier, Florence Gramling, Marguerite Lincoln, Millicent Lincoln, Thelma Lockhart, Elmer Munson, Mary Nady, Barbara Nickerson, Lorraine Roelofs, Virginia Turner, Jean Wheaton, Pete Zamperini. Madrigal Society Margery Roelofs President Leo Sweeney Jean Wheaton Vice President Pete Zamperini james McLean Seerezag' James Lanz Mildred Rodgers Wardrobe Mirtrerr Katherine McNeil Esther Terry , Librarian Bernice Baker Lillian Frazier Hirrorian Arthur Yamamoto Barinerr Manager Carl Quayle Sergeant-at-Arm: James McLean Mrs. Eischen, Adviser The Madrigal Society is one of the most successful organizations in Torrance High School. Their outstanding feats this year were the Christmas aud. call and Torrance Benefit programs, and the making of a phonograph record by the Whole chorus featuring three songs. The Madri gal Singers are noted for their tone blending quality and enunciation. M E M B E R 5' Bernice Baker, Van Bartechko, George Bradford, Emily Bechtel, Virginia Bowers0x,Jack Christensen, Vernon Coil, Lola Cokeley, Norma Buekler, Bill Colburn, Roberta Colburn, Margaret Condon, Earl Doner, Ceclia Ernst, Lillian Frazier,Joy Fossum, George Lancaster, Bill Lanz,james McLean, Katherine McNeil, Elmer Munson, Barbara Nickerson, Ula Paisley, Lorraine Roelofs, Margery Roelofs, Jacqueline Rogers, Mildred Rodgers, Trixie Rowell, Edith Stevens, Leo Sweeney, Esther Terry, LeRoy Thompson, Virginia Turner, Jean Wheaton, Authur Yamamoto, james Lanz, Paul Lessing, Leonard Lock, Carl Quayle, Pete Zarnperini. Page Sixty-Five v , THE TORCH, NINETEEN THIRTY-TWO , . . Boys Junior High Glee Club First Semester Oliicers Second Smester George Bradford Prerident Fred Ralston Bob Wertz Vice President Bob Wertz Takoshi Kiyomura Secretary Billy Atchison Hitoshi Hatado Sergeant-at-Arm.r Roger McGinnis M E M B E R S Billy Atchison, Alfred Bunje, Walter Bunje, Ellsworth Clark, David Clark, Earl Clayton, Tokishi Kiyomura, Joe Gossiaux, Roger McGinnis, George Bradford, George Isbell, Jack Monahan, Hitoshi I-latada, Alfred Speed, Talmage Ulrich, Fred Ralston. Junior High A Cappella Choir Officers Prerident . .... . . Bob Wertz Vice Preridenr ...... Roger McGinnis Junior High Girls' Glee Club Oflicers Preriolent . . . . . Lillian Hilpert Viee Preyidenr . Frankie Cooke Secretary-Trearurer . Marguerite Darling Wardrobe Mirtrerr . Chrystene Ingram Librarian . . Blossom Roque Amirtant Librarian ..... Ruth Barnard Once a week on Mondays this club meets. Tuesday it meets with the Boys' Glee Club to form the Junior A Capella Choir. 1 MEMBER! Ruth Barnard, Emily Bechtel, Roberta Colburn, Frankie Cooke, Marguerite Darling, Muriel Gilbert Lillian Hilpert, Georgiaine Humer, Chrystene Ingram, Vida jones, Ella Levy, Gertrude Mowry, Toshie Nagayama, Lenna Nelson, Mary Ortego, Blossom Roque, Betty Stevenson, June Turner, Margaret Walker, Evelyn Weaver, Doreen Willett. The Orchestra First semester Officers Second semester Marguerite Lincoln Manager Marguerite Lincoln Francis Mowry Librarian Bobby Elder junior Lane Axrixranr Librarian Eric Chaplin Thelma Lockhart Seeretagf and treatarer Fred Ralston Mrs. Eischen, Aolvieer For the first time the orchestra attempted classical music. They gave much help to the school this term by assisting at some of the Senior High Sings and at the Senior and Junior play. First Violinr Second Violin: Cornet French Horn Ellsworth Clark Bobby Elder George Isbel Francis Mowry Marguerite Lincoln J unior Lane Trombone Piano Evelyn Moss Cellar Talmage Ulrich Gloria Zahradnik ' Saxapbone Millicent Lincon Drama Thelma Lockhart Gertrude Mowry Fred Ralston Page Sixty-Six TORRANCE HIGH SCHOOL -I-Z'Z'Z"!"!"S"?'!"!"Z"2"5-'Z-'E"I"!"!"IM!'Z'IM?'?'5'?'?'5'E0Ew?'2"!'4'i'2'2'4'i'4"!"!'?'?'5'4MZ"?'I Above, Orchestrag Below, Junior High Glce Club Page Sixty-sc en TORRANCE HIGH SCHOOL ,J ,av an nviogvnfgygva-avxyav-Q v..o-fights,,vrrenvnv o y..v..n,,v qgehvhv heaving..o,,Q..q,,y..v,.o,,o..v,.v,,v yMQ..v..v,,o,Q 1 -,Junk . . . 4"."f". r'r"rvu v'r'v."."."r'r'r's"x"z"X"x":"v'."4"4"."ws"f F51 w.'V?'f'f'4"4"."."c'w".". a"."4"."6"."2 . . . The Makers of The Torch This issue of the Torch is produced entirely in the School printshop, All the mechanical work was done by the boys and girls shown in the above picture, assisted by the A-8 boys and other pupils taking their first term of printing. Special credit is due to the following pupils: Type setting Foremen: Robert Nourse, Pete Zamperini, Russell Quigley. The advertisements, were set by Roy Hayes and Vernon Coil. Assistants in the special typesetting room were Earl Srnithhlames Coil, Vlad- imir Micanovich, Henry Bruhanski, and George MacDougal. Makeup: George Lancaster, Jack Hutchins. Press work: Foremen, Bill Lanz, Leo Sweeney. These two boys have done unus- ually clever workin making chalk overlays, and by special care redeemed a few engravings which were almost hopeless, due to poor photography. Assistants in Presswork: Earl Doner, James Lanz, Paul Getz, Noel Temple, james McLean. Bindery Forewoman: Bernice Baker. Special mention is due Claudinajohnson for exceptionally clever work in inspection of the finished sheets. Helen Haworth did an unusual piece of good Work in drawing and cutting the embossed monogram on the last page of the cover. Margery Roelofs, taking her first term of printing, assisted by Lola Cokely and Bernice Baker, handled the work on the newspaper so that it did not interfere with the work on the annual. Thanks are due to Millicent Baker Morris, former valued printing student, for the block-prints on pages 29 and 43. The entire printshop' force worked faithfully under trying conditions. Page Sixty-eight U Ar TORRANCE HIGH SCHOOL A 2'2Y:!.JL':'a9:'- 53.3203 ..!..Q. J. .Q. .Q. .0. .f. .v. .9. .v. .Q. . , .L .9. . , .v. Literary Day Dreaming I saw a ship a-sailing today Across the white caps of the bay, And as she swept across the waves To where the great green sea-god raves In fancy I, aboard her, Went down to Mandalay. DE Loss NEAL, B-11 Night on the Desert As the sun sinks beneath the desert floor, Shadows creep around my door, The lone wolf starts his haunting cry Against the darkness of the sky. And in the silence of the night Strange sounds are heard before dawn's light. MYRON NIGHTINGALE, B-11 Clouds I love to sit and watch the clouds As they go drifting by. They seldom give the same shape twice Or in the same position lie When winds sweep o'er the sky so blue, lt makes the clouds like little sheep, Soft and white and fleecy-like, A lot of snow-balls in a heap. Sometimes they look like great white ships Sailing on a deep, blue seag Or like a babe in a snow-white bed, As lovely as can be. It must be nice to sail along Without a care, with head unbowed- just sail along with the shifting winds- I wish I were a cloud. JEAN WHEATON, B-11 Page Sixty -N THE TORCH, NINETEEN THIRTY-TWO . .. .A.. .... ., ,4,, .. ,,,,AA.AA, .. .AA.A ...r.r.r.r.r.r fm-Weww4-MNWW.F.-.f.f.f.f.f.f.f,f.f.f.T.f.f.f.f.f.f.f.f.+zf.f.f.T.f:9z-ew.g.....W....'-.-- Page S Sea Lights ln the silvery deep of the sea, Where lie dim hulks of ships, Wrecks lie untold, it seems to me, Of Roman galleys with bronze tips. Here in the watery vault Huge monsters hold sway, And the tides batter and assault The skeletons where they lie- It is another world, obscure and dim, Many, many fathoms beneath, Where slimy shapes dart and skim, Only to disappear between hungry teeth As Day slowly dies away And Night spreads her veils The stormy waves roll and sway, And calm besets the swales. An opaque darkness reigns, Lights twinkle here and there, Presently there can be seen, veins Of blazing phosphorus everywhere. For Fishland has a lighting system, As we land-folk do. And when o'er the sea darkness falls, The sea folks light their candles too. Elmer Munson, B-11 California Yucca The mountains are beautifully dressed With yucca so showery and white. Those lovely flowers have blessed Our landscape with delight Their gorgeous white bells are massed On stately stalk and gently caressed With soft zephyrs of the night. GERTRUDE PETERSEN, B-11 cventy TORRANCE HIGH SCHOOL .eahehravmvh hfavgmfhsghvhsmvhfhvghvgvhvaf..vghQ..y..e..o..f..ohv..v..o.1..0 .Q..x..shrm'BmmfA'gh'afmvavava'a'mvJl'g..f..r..v ' -r-4--.--vv- -- - rv-4--wr-v-v v'Q-w-w--v'.w-I--Fr-rv-Ffffr-Fffifff1-1'-ws--rw1--r'rs--rv-.--rvvvw--re "x"x"a":"f' Why Bubbles Come to the Surface of the Water Once upon a time, there was a lonely young fisherman who went out each day to the sea to get his nets of fish. Each day he would dream, as he Hshed, of the time when he might see a mermaid, for he had always believed there were such people. One day while he was fishing, a mermaid came to the side of his boat. He could hardly believe his eyes when he saw her, but finally he spoke to her and asked her to come into his boat so that he could take her home with him. 'She said that she could not leave her ocean home, but that she would visit his boat as often as she could. On the days that she could not come, she promised to send on beautiful thoughts to him. The beautiful thoughts, in the form of bubbles on the Water, came to him, and he would catch them in his hands. To his amazement they turned into pearls and he found himself a very rich man. But, in all his happiness he did not for- get his mermaid friend. JACQUELINE PRICE, B-9 The Lane As I walk up the lazy lane, With poplars on either side, Every flower and breeze recalls Sweet memories of nights so sweet, Thejune night and the beautiful moon, Oh how, I wish that I could live Those days again. I would go up That same old path, that same old lane. THOMAS MCNEIL, B-11 Nothing I sit down at the table to write on a subject, But I think of nothing. I think, I ponder, and still I think of nothing. So time flies and leaves me still thinking of nothing. I get up and pace the floor, Because I am tired of thinking of nothing. But, try as I will, I still think of nothing. At last with a desperate hope, Iask my mother, But she gives me nothing. "Oh dear," I sigh, as I think of nothing, What shall I do if I think of nothing? And so, disgusted, I sit down and write about nothing. NEWELL ANDERSON, A-9. Page Seventy-One THE TORCH, NINETEEN THIRTY-TWO hangar ..A,.., .,.,..,.,,..,.A.A.,,.,AA,A.,. The Beautiful Garden of Toys By the boreal pole Where old Santa Claus lives, In his cottage of taffy and glass, In the summer his sleigh Is well packed away, And his reindeer are pastured on grass. There the Saint reads, And the Saint smokes his pipe, And leisurely the hours he enjoys: But on the mornings he goes With his rakes and his hoes To the beautiful garden of toys. Oh! the garden of toys Is well planted with seeds Of every plaything that's out. Long rows of tin whistles, And horns thick as thistles, And popguns beginning to sprout. The marble plant, too, Is just coming in view, A crop of delight for the boys, As the Saint showers the lot, From his watering pot, In the beautiful garden of toys! DOLORES KING, B-ll nty-Two QQSXC T lv Q, TORRANCE HIGH SCHOOL ,f -g.g.g.g.L,afa.L,nfnQfuafawa,:,,,L.a.,,L.,.g.a.,.,.,,a.a.A..:,G.a.,.,2,,,.a....L,JJ,,L,..,...,., , .......,...,...,.i,,..,,,, . an . . . .f V. -4--5--ff.--.WW.-Y.-f.-f. 5--6--.-W.-v.ff.H.1--.--.V'.ff.--.'-.-fm--rwvm'1--."m--.-'.-f.-V.--.fm-.f.--m-lf.-'mfmf.--f-1+-r Too much praise cannot be given the men "behind the guns"-those who serve earnestly and patiently that the ef-fort of others may bring credit to the school. Attendance at all games is a valuable service to the school in which every one can be a participant. WILLIAM THURMAN The football and basketball seasons have once more passed into the history of Torrance sports. As basketball season ends, I cannot forget two outstanding impressions: First, that the football and basketball teams of the past year have exper- ienced a heartbreaking season, Fighting their op- ponents to a standstill and yet losing their games by two or three points. Second, that in spite of this unfortunate setback the fighting spirit of the teams has been so remarkable that our opponents have not only congratulated us time after time up- on this wonderful spirit, but have openly admit- ted that they were actually in fear df the bunch of fighting Tartars at Torrance High. EARL FIELDS Upon viewing the past year in high school activities, one is impressed with the spirit and cooperation shown by all concerned. I think we are all well up towards the top of the ladder fsuch a ladder as would represent the life of a schoolji Iam looking forward to another such year in which we may climb even higher in all respects. RAYMONDSMITH Seventy-Three THE TORCH, NINETEEN THIRTY-TWO !"Z"Z"E"i''Z''I''Z"Z'Z''Evi''Z"Z"2"Z"I"Z"Z"Z''5"!"I"I"!"'r'Z''!"'r'!"Z"I"5"i"5"Z"i"!"I"!"?'?'Z"i"!"Z"!"5"i"Z"E"I"!"Z"?'5"Z"5' CgVK!?f77L eSevcr1ry-Four -TORRANCE HIGH SCHOOL . . 'f"5"5"E"5"5"5' 9+'5"fMf"Z"I"f'4"I'4'iMZ"I"I''I''IMI'I"I"f"I"I"I"Z" ""I''I"I"i"Z"f"I"I"Z"I"Z"Z The Football Team LEO SWEENEY GEORGE FIGUEREDO Dangerous in the open field. A good quarterfbackg cool under tire. LOUIE BRIGANTI MILTON EVERETT A good line plunger: hits low A SCFIPPU at all flmfg RUSSELL QUIGLEY CARL QUAYLE ELMER RILEY Sure. Fast and a good lighter. A line taekleg hard to srop when playing his best game. JAMES MCLEAN WILLIE AGAPITO A good OPm'HEld funnel' A good all-around player. with lighting spirit. ,IOHN HARRIS FRANCIS BUCHIVIAN BOB ATC!-IISON A good defensive player, A hard-smashing fullback. Always can be depended upon .hard to get by. LARRY STEVENSON DICK MASON A hard worker and conscientious. Has the real Torrance spirit. BILL HARDER TONY NATALE New. but has lighting heart. Never gives uog a good guard. JOHN PFLUGH Always good for yards when past the line of scrimmage. IUNNIE ROGERS ,IOI-IN SELBY Very fastg dangerous on end runs A real Cuprain HERMAN HAMMAN One of the outstanding tackles in the Marine League. ' EARL DONER Another good guard with plenty of scrap. asset to the squad. LE ROY THOMPSON When he was at his best, he was hard to beat as an end. Page Seventy five THE TORCH, NINETEEN THIRTY-TWO 9veeeoeowwevwoasEQ2'mv2Q2wmvmqafaeavaeavavavaonvnv:1:14o4vivavQoaoaeaoasnoiqivmeiqxymeLvgoioanavavavaaAqrorv-o-1-v-Q-1-Q 1 . A 4 4 5 a a 4 4 s'-rw vw vw rvrv Q rv s r'a"r'r'r'v'r'r'v rvvvv 4 s"r'o"r'r'n''r'r'r'rx va"r'c"v-rw''rrw'' . Football Games The Torrance football team of 1931 was one of the best in the history of the school. Every team that played them could not help but offer them their respects as to their fight and clean playing. Torrance has every right to feel proud of its football team of 1931. Narbonne 13, Torrance 6 This was the first league game of the season. The boys won much praise for the fighting spirit they showed in the comeback of the second half. El Segundo 16, Torrance 14 The Torrance team has no excuse to offer for the loss of this game. It lost its punch in the second half, having made all 14 points in the first half. South Gate 6, Torrance 6 A good game. Both teams played well. Leuzinger 2, Torrance O This was the best game of the season. No touchdowns were made. Leuzinger got her two points by a lucky break and won the game. However, alter the game it was discovered that the score was tied O to O. The referee ruled a touchback as a safety, which was incorrect. Banning 26, Torrance O Banning showed great strength against us from the first of the game. But our boys were plucky and stuck it out until the end. Gardena 27, Torrance 6 We tied Gardena 6 to 6 in the first half, but failed to hold in the second half and lost to them. Our boys fought bravely and deserve a great deal of credit for this last game of the season. Page Seventy-Six TORRANCE HIGH SCHOOL .,,,,,n,n,aLJ2,A-Lua,.:.,wa.L.n,n,n.Jan,.n,n.a.g,n,,.n..L.,,.a.JL.J-.LL.Y.4,:.:.,.a.JJL.Jl,:.n.n.a'a.,,,, - . -- -- -- f- "avr4"r'o"r's1"4"o'1"s"fo"o"o"b"b -.'-.-ww- .V . Frm--.--.--vw.--.--4--.--s--. .V-.-V.--.--.--.--.-Y.--v .--.V .-V.--.-tm' Baseball The Tartar baseball squad at the opening of the season of'32 looked very pro- mising. Although such stars of the past season as Wilfred Tidland, Elwin Jarrett, and Willie Agapito were missing, the squad was supplied with more players than last year. There were two complete teams taking the field every afternoon for prac- tice. One team called team A represented the varsity, and the other team termed team B comprised the smaller and experienced players. Yet, in spite of these handicaps, the latter were capable ball players who were called upon for substitution when- ever the need occurred. At the time of writing, the opening of the season was yet two weeks away. The only basis upon which the Tartar baseball team could be judged was the result of a game with jordan High, a practice game in Jordan's field. The score was 4 to 4 ' which was encouraging, considering the strength of the powerful Jordan team. The team this year has no outstanding stars, instead, it is made up of 1 well-rounded nine. All of them play a fair game, yet no one player is outstanding. There is more team-work and co-operation among the players this year than was demonstrated last year. A brief survey of the players resulted in the following line- LIPSZ Team A Takashi Kiyomura . . Pitcher . Bob Atchison . . , Catcher . Herman Hamman . . lst base . Pete Zamperini . . . 2nd base . Garland Johnson . . 3rd Base Leo Sweeney . . . Short-stop Charles Williams . . Left Field Carl Paxman . . . Center Field Tony Natale . . Right Field age Team B . . Lendel Elder George Figueredo . V. Micanovich . . john Nady Bob McTaggart . Melvin Smith . . Earl Smith Milan Micanovich . Ted Yamamoto Seve-nty-seven THE TORCH, NINETEEN THIRTY-TWO 44- ,Q'ig'a'JaQ..faLf Vvgggxv. .v. -'aL'a'aLfa'a'aL'Q'- Av- A -var .vxvgl msg. ng. Aus- -M -fJa'avJa'az..r.. fu s . ff ww.--r'c".' . rv w'x"rvv fvrfv rr r'."x". ra--s--P. f .--v-rs s"r'f rv .ffvrvf Basket-ball Teams Above, Class Ag Below, Class B ,Page Seventy-eight TORRANCE HIGH SCHOOL 'FrEeleieeieieieEfrieeieielelniieiefefieieieeieWeIeI+Z+FIeZeIeieieieieieieelerieiei-v "f fieieleleiei-1-w"''eIeI+fIeIeI+Z+rZ"2"5+'5r'!'-9 Basket-Ball Torrance should feel proud of her basketball teams of the season of '31, Practi- cally every game was not won until the Hnal whistle had blown. The scores were close, in most cases a difference of only 1 or 2 points. The players and the coaches worked long and hard to get the best results possible, and their effort was rewarded by the marvelous light, team play, and close contested games which the Torrance teams produced. Class A The Class A were against the usual handicap of lack of weight and height in comparison with their opponents. In spite of those big differences the varsity played a slashing game throughout the season. The peak of their playing occurred during the game with the champions of the league, namely, Banning. The game was of the most intense excitement throughout, and when it ended the score was 18 to 18. It was necessary, therefore, to play an extra 3 minutes, during which time the Banning guard shot a long goal from the center of the court, which won the game for the league leaders. Players Games Norman Barck fcaptainj, guard Jacob Gall, guard Edgar Reeves, center Mike Micanovich, forward Pete Zamperini, forward Ivan Eckersley, forward 24 Narbonne 39 El Segundo 23 South Gate 10 Leuzinger 22 Banning 23 jordan 20 Torrance 4 Torrance 22 Torrance 17 Torrance 18 Torrance 16 Torrance Harold Watson, forward Eldridge Warrington, forward Willard Barnett, center Class B ' The B team Was perhaps the best representative of the Torrance teams, plac- ing third in the combined Marine League. This team was composed of a group of play- ers Who were always hghting, and who where at the same time good all-around basketball players. The B team was also light in comparison with their opponents, but their speed, passing, and excellent shooting carried them on through the race to almost the top. Players Games Arthur Yamamoto fcaptainj, center O N arbonne - 0 Torrance Eldon Zanon, forward 11 El Segundo 14 Torrance Bob McTaggart, forward 16 South Gate 24 Torrance Milan Micanovich, guard 12 Leuzinger 31 Torrance Bob Carson, guard 16 Banning 6 Torrance Melvin Howard, forward 26 Jordan 16 Torrance Lendel Elder, guard Narbonne forfeited to Torrance Jack Christensen, guard Page Seventy-nine THE TORCH, NINETEEN THIRTY-TWO .5..g..5..5.aagttgagagagagagtgagagagagtgagagagagagagagagagagagagagagag2qagagag:13:1gagagagagagag?ggagagagagagaagtsgaggagaag. Basket-ball, C ontinued Class C The C team can be Compared with the A team in the sense that the scores were all close and that they did not win many games. However, they fought des! perately, only to lose by a small margin of one point. It was discouraging to con- tinually meet these setbacks, yet they always went on with determination to win for Torrance. The coaches feel as proud of the team as though they were cham- pions. Players Games Cornelius Peet, forward fcaptainj 11 Narbonne - 5 Torrance Joe Disario, forward O El Segundo - 2 Torrance Ted Merrill, center , 8 Southgate - 6 Torrance Kenneth Fess, guard 11 Leuzinger - 5 Torrance Ted Yamamoto, guard 22 Banning - 14 Torrance Horace Andrews, forward 8 jordan - 7 Torrance Myron Nightingale, guard El Segundo forefeited to Torrance l James Carlin, guard Class D The D team was the running mate to the B team in the respect of games won. They liinished well up in the front, winning the majority of their games. This group of little players was the smoothest working team of all the combined teams. Their floor work reverses in motion, passing, shooting-all the other fundamentals of basketball-were indeed a revelation to all who watched them play. This team lost only three games, losing two of these by just one point. The D team was on the threshold of a championship. More power to them next yearf Players Games Susumi lshikawa, center fcaptainj 9 Narbonne - 8 Torrance james Grubbs, forward 10 El Segundo - 28 Torrance Hal Smith, forward 5 Southgate - 29 Torrance Henry Dossi, guard 3 Lcuzinger - - 9 Torrance James Miller, guard 15 Banning - 9 Torrance George Miura, guard 9 jordan - 10 Torrance Dale Howe, forward P a g e Ei g h t y ., af, TORRANCE HIGH SCHOOL r C91 ' 1 bi- .ff . ' B L ,- ,Y .l Q " x,5w-fffig, 5. wi L Q 7- Q I' fffi Wziz, Basket-ball Teams Above, Class C5 Below, Class D so gc Eighty-o ,L k H fi lv"YV'Qerg Es , .jizm,,1pf lil' .f 'uk L H A X TORRANCE HIGH SCHOOL ..g..g... gag... 1.0 ,. , . .11111 . , . . ,11'1Q1Q,1,1 QaLL',1wJ1f1,1f1'aQ1'1,mg 1,1o1'1.JavJ1'11'1y1v1,1y1,1f1'1Qa'1'11.11, . 'E' ."."."."r'."."."."r'5"r'rs--r-vw'-:fr-v-vw-w'1 v-raw'r."a-fv-rwvw-vv rf .-6--4--.--rv-vw'rvv."r'. "' Track Team 1937. Torrance High Track Records 100 yards 220 yards 1 1 440 yards Mile 1 11 880 yards 11111 111 880 yards 120 yard hIg1f1iLiffi1E11111 220 yard low hurdle Pole vault zzxn, 111 1 1 High Jump 111 111 1 12 lb. shot put 1 Broad jump ,v,, 880 relay ,.,, 50 yards11111 50 yards 1111 1 100 yards1111 11 120 low hurdles 1111 660 yards ,,-,,,,, Pole vault ,,,,,, 1 8 lb. shot put 1 111 Broad jump 1 440 relay 1 1 1 Pagcliighty-two Class A 10.1 ,,,1,-,1,11,-v1, 22.8 1111 1 54 sec. 5 min. 3 sec. 2 min. 6 sec 2 min . 6 sec. 11,11111 116.4 sec.1 26 sec. 1111 10 ft. 6in. 5 ft. 7 in. 1 39 ft. 1111 119 19 ft. 9 in.1 1:35 11111 -211111 Class C 5.4 1111 11 11111 11 111115-41111 11111 10.4 14.4 1.34 11111111 11111 10 ft. 7 in, 111111 111 39 ft. 7 in. 1 111111 1 19 ft. 6 in, 11111111 111149.5 11111111 Bill Lanz Jake Gall 1111 1 111 Roy Keener 1111 1 Bert Merrill 11111 Pete Zamperini 1 11 Bert Merrill 111111 11 Bert Merrill Charles Montague 1111 Art Yamamoto 1 1 Bob Atchison Joe Higgins 1111111111111 11 1 Thompson, Yamamoto, Luck, Lanz 11111111111 11 1 Billy Acree 1 1111 1 111 Susumi Ishikawa 1111 Susumi 1shikawa11 1 1 Ray Rogers 1111111 Louis Zamperini 1111 Susumi Ishikawa 1111 Milton Everett 111111111111 Billy Acree 111111111111111 Wcrtz, Kubo, Miura, lshikawa 1111111111111111 Le Roy Thompson 11111111 11932 1931 1931 1932 1930 1932 1931 111 111931 111111932 1932 1931 1931 1932 1931 1932 1932 1930 1932 1932 1931 1931 1932 TORRANCE HIGH SCHOOL ""'ffI+!+IeZeIeI+!++Z+Ie!f'r-z-w-'""'f A.A.U. Invitational Relays at Long Beach The Torrance team placed first in the medley relay and won four gold med- als. The relay team was composed of LeRoy Thompson, Bill Lanz, Emilio Adamoli, and Pete Zamperini. The Los Angeles Relay Carnival Our class A team placed third in the medley relay, and won four bronze medals. The relay team was composed of LeRoy Thompson, Bill Lanz, Emilio Adamoli, and Pete Zamperini. Our B and C team placed third in the mixed medley and Won four bronze medals. The team was composed of Bob Wertz, Hubert Luck, Susumi Ishikawa, Roy Keener. To the present day, all school records have been broken excepting the 220- yard dash, 440-yard clash, 880-yards, 120-yard high hurdle, 220-yard low hurdle, broad jump, the class C 50-yard dash, 120-yard low hurdle, 8 lb. shot put, and broad jump. The following boys have set new records: Le Roy Thompson did the 100 yard dash in 10.1, Roy Keener did the mile in 5 min. 6 sec., Charles Montague pole-vaulted 10 ft. 6 in. Art Yamomoto high-jumped 5 ft. 7 in. Bob Atchison put the 12-lb. shot 30 ft. The 1932 880 relay team set a new school record, time 1135.2 The team was composed of Thompson, Yamamato, Luck, and Lanz. Susumi Ishilcawa did the 100-yard dash in 10.4. Louis Zamperini ran the 660-yard in 1.34. Susumi lshikawa pole-vaulted 10 ft. 7 in., this was also a new Marine League record. 440 relay time 49.5, the team was composed of Wertz, Kubo, Miura, and Ishilcawa. Page Eighty-three THE TORCH, NINETEEN THIRTY-TWO 'ZwittlstifsieIeieleieiieieieieiffiehtieivdeleieieieIeleieie!1 fieleissieieieieieieitlieieieiell 2ZeIeIe!eZeIe!+!eZe'e'f f'eZeeZ+sIe!eZ"i- Tennis The tennis prospects for Torrance for the year of '32 look promising. The team is composed fo practically all new members, Francis Mowry being the only ve- teran from last year's squad. The Torrance "racketeers" had their first test against the Manual Arts tennis team on Thursday March 31, at which time our alma mater succeeded in defeating the visiting team from the big city. The squad and the coach are hoping to check some victories for Torrance this year in the forthcoming tennis schedule. The team is composed of the following players: First Doubles Second Doubles First Singles Second Singles Francis Mowry Ted Merrill Gene Tolson Horace Andrews Homer Kirkpatrick Cornelius Peet Kenneth Fess, Mgr. Golf The golf team was hard hit by the loss of such players as Paul Sleppy, Norman Barck, and Edgar Reeves from the '31 golf team. However, we are fortunate in having Captain Joe Disario, who represents one of the outstanding golfers in the Marine League, shooting consistently under a score of 80. The remaining golfers however are handicapped by the lack of practice and experience, which are both vital to "Old Man Par". The success of our golf team this year will depend upon how rapidly our industrious but mediocre players can develop into real good "match players," in which case it will mean victory for our squad. More power to the future Bobby Jones of Torrance. The members of the golf squad are as follows: Captain Joe Disario, Kenneth Haslam, Roy Keener, Bob Carson, Melvin Howard, Jack Christensen, George Bradford, Bill Harder, Manager Tom Rogers. Page Eighty-four TORRANCE HIGH SCHOOL W!H5'i'Jrf'?4G+Z-2f!'iE++i!wZ"Iw?+!i+fEfZ++!WZ'+!++ZW!HZ'4MZ"Z"2"5'-5"2"5"IW'2'Z"!"!"i'n"+Zw4"Z"?'Z+'Z"'r'!" Above, Tennis Teamg Below, Golf Team Page Eighty-F THE TORCH, NINETEEN THIRTY-TWO sf-rv-r-rr-r-a' . 4'v1-'www--4--4.--5--f . vw. sw rv1ffw.'f.w'vvvv-.--.--.--a- . aw f 4''F4TFFFFFFFF.fffaiif.' Girls' Inter-class Sports Speed Ball Owing to the plentiful rain this season, the speedball games were cancelled this year. However 100 G. A. A. points were given to those who came out to practice. Frerhman Emily Bechtel Patricia Carlin Vivian Carroll Frankie Cooke Thelma Dilthey Alice Dossi Elizabeth Edwards Ruth Granger America Hadler joy Heglie Olive Belle Huber Connie Hudson Margaret Kibbe Page Eighty-six Dorothy McMillan Beatrice Riley Lorriane Roelofs .fopbomare Pearl Gilbert Mae Guy LaGretta Hall Rose Higgins Norma McCormack Virginia Mikelson Elsie Price Inez Smith Edith Stevens Ester Terry Samiko Wadamato Mary Whalin Vivian Young junior Aldine Brown Ruth Nelson Mary Ogata Hortense Price. Senior Bernice Baker Isabel Burdick Margery Roelofs Ruth Wilhelm Florence Gramling TORRAN CE H IGH SCHOOL "Keir -Zvi''M'ti' ?M02NI4NINZ'k!''Z''I"I"2"i"2"?4"Z"5"!"!'4"I"Z''Z"Z"Z"Z"Z"Z"Z''S"M'4 Hockey Because of lack of time the hockey games were not played. There were about three hockey teams in each gym class. The first team received 100 G. A. A. points, while the second team members received 50 G. A A. points. Every hrst team beat the other teams in their gym class except the period-three team. This team was held to two tie games by the second team. Period Three Marie Batsch Mary McNeil Patricia Carlin Alice Burger Florence Gramling Samiko Wadamato Fern Smith Aggie Lou Rippy Ruth Wilhelm Jeannette Mikelson Ula Paisley Mary Whalin Jacqueline Rogers Lola Cokely Alice Gall Period Four Shizuko Kazama Myrtle Gregg Mary Ogata Hortense Price Elsie Price Eve Hamman Haruko Minami Beatrice Riley Marguerite Lincoln Trixie Rowell Joy Heglie Emily Bechtel Norma Hudson America Hadler Thelma Dilthey Olive Bell Huber Period Five Mary Nady Bernice Baker Lorraine Roelofs Margery Roelofs Elizabeth Neelands Vivian Young Isabelle Burdick Connie Hudson La Preal Harris Dorothy McMillan Virginia Mikelson Rose Higgins Mae Guy Jean Wheaton Barbara Nickerson Edith Stevens Margaret Floyd Betty Danford Period .fix Fern Wright Lucille Thompson Alice Fenneman Olga 'Iaunsem Arbelle Kirchner Aldine Brown Melvin Lockhart Merle McTaggart Marie Smith Inez Smith Ilene Folk Blanche Lukes Vivian Carroll Margaret Kibbe Irene Fix Verna Mae Long Agnes Peet Page Eight Sev VM.. TORRANCE HIGH SCHOOL -I"Z''I"BNIMZ"Z"!"I"Z"I"2"I"E"!+'3"5"3"2"!'E"I"5"Z'-2"'r'Z"S'-I"E++Iet2"Z"ietI+f!"!eeie+Z+!eI+!eZeZ+i!+e2tt!"Z"Z+!+!'E'+I+t!+t5"5'+'I'tI++t!"1' Girls' Inter-Class Basketball Basketball season opened with much enthusiasm, all classes except the juniors having two teams each. The spirit was fine, for it seemed as if every girl turned out for the grand sport of basketball. Most of the games played were exciting, although some of the scores do not show it. The sophomore I's won the championship. Sophomore I 1.000 Junior .500 Senior II .OOO Senior I .666 Freshmen II .500 Sophomore II .OOO Freshmen I .SOO The scores of the games were: Senior I 40 Senior II 6 Senior I 17 Junior 12 Freshmen I 28 Sophomore II 7 Juniors 25 Freshmen I 11 Sophomores I 13 Juniors 7 Sophomore I 29 Freshmen II 7 Sophomores I 25 Freshmen I 9 Juniors 18 Seniors II 7 Sophomores I 17 Seniors I 7 Freshmen I 32 Freshmen II 17 Sophomores I 34 Sophomores II 4 Freshmen II 22 Sophomores II 18 Freshmen I Frerhmen II Sophomore I Patricia Carlin, F., Capt. Olive Belle Huber, Capt. F. Dorothy McMillan, F. Vivian Carroll, F. Margaret Condon, F. Joy Heglie, C. Adeline Shoptaugh, F. Beatrice Riley, C. Ruth Granger, C. Jeannette Mikelson, C. Emily Bechtel, C. Vee Kaspar, C. Margaret Kibbe, G. Nadine Sherwin, G. Martha Greaves, G. Sophomorer II Millicent Lincoln, C. Elizabeth Neelands, C. Barbara Nickerson, G. Jacqueline Rogers, G. funiorr I Eleanor Austin, G., Capt. Ruth Nelson, G., Capt. Virginia Mikelson, F. Helen McMaster, G. Vivian Young, F. Jean Wheaton, G. Edith Riley, C. Kathrine Fritz, C. Jean Solomon, C. LaGretta Hall, C. Helen Smith, G. Lucille Thompson, C. Evelyn Colburn, C. Gertrude Peterson, C. Hortense Price, G. Aldine Brown, G. Pearl Gilbert, G. Mildred Eshorn, G. Rose Higgins, F . Marie Batsch, F. Margery Roelofs, F. Senior.: II Mildred Austin, Capt., Laura Servaas, C. Audrey Clafks F- Jean Crawford, Sr., C. Page Eighty-eight May Guy, Capt., F. Elsie Price, F. Alice Burger, F. Norma McCormack, C Edith Stevens, C. Mary Whalin, C. Betty Danford, G. Inez Smith, G. Margaret Floyd, G. .Yeniorr I Ruth Wilhelm, cap. F Virgina Turner, F. Olga Jaunsem, C. Blanche Lukes, C, Florence Gramling, C Mary Nady, G. Trixie Rowell, G. Genevieve Guyan, G. Rose Agapito, F. Dolores King, G. Irene Fix, G. Jean Hudson, G. TORRANCE HIGH SCHOOL JV: 2920: :fm 29212121gQ:!m!:!:L..'L'49:9:Y29i 29:!.JL9L'lY..!J':f..!M!.JL'L'a QDVLL Play Day at Narbonne Narbonne invited Gardena, San Pedro and Torrance to its play day on No- vember 24. Torrance girls had a keen time, even though they only won two games, namely: archery and horseshoes. The different games were playedg then relays were run off. The refreshments were pumpkin pie and punch. Dancing was the next feature. All the girls had the right kind of spirit with which to make this play day a success. The scores were: Senior Basketball: Torrance 10, San Pedro 17. Sophomore Basketball: Torrance ll, Narbonne 24, Volley Ball: Torrance 16, Gardena 43. Archery: Narbonne 74, Torrance 96. Horseshoes: Torrance 2, Narbonne 1. Tennis: Narbonne 6-4, Torrance 6-2. Handball: Gardena 11, Torrance 7. The girls who played in sports were: Tennis'-Lola Cokely and Dorothy McMillan. Handball-Eleanor Austin and Jean Crawford, Sr. Horseshoes-La Gretta Hall and Jean Hudson. Archery-Lillian Frazier and Isabel Burdick. Volley Ball Basketball Marie Batsch Margery Roelofs Rose Higgins Irene Fix Aldine Brown Helen McMaster Ruth Nelson Beryl Talent Vivian Young Mildred Cowan Smiorx Ruth Wilhelm Rose Agapiro Blanche Lukes Mary Nady Lucille Thompson Trixie Rowell Pearl Gilbert Olga Jaunsem Sapbamorer May Guy Alice Burger Elsie Price Norma McCormack Laura Servaas Mary Whalin Betty Danford Inez Smith Margaret Floyd Page Eighty-Nine THE TORCH, NINETEEN THIRTY-TWO . ,.o..f.,q..e. no .ado ony..- -fs-f?7f..x.v.a of -'vlfffi -'- J- -'i'a'ifatnfmrnenrnrnrhvnrhrhvhemQnvnfnrnrnrmenrnvmrnsnrnQnrnrnfnrnvnfnvnvn1n0nrLv,vnv,', - Wx Q 4 s"'r'x". v'rwvv-r'a-vw-'s''v-s''v-v'a"a"v's-'x"v'v'ra'-s"s"s-'a"s--v'vw vs-1 rs- r rs'-vvvw'-rw' rw Torrance Play Day On December 2, Torrance entertained San Pedro and Narbonne at a play day, After the games were run off, the girls marched to the cafeteria where ice cream. cake and cocoa were served. Following refreshments a snappy play in the auditorium was given, in which Lillian Frazier, Jean Solomon, Inez Smith and Helen Smith were the characters. Dancing was then enjoyed in the gymnasium. The scores were: Basketball Torrance Sophomores 4, Narbonne 11. Torrance Juniors 16, San Pedro 14. Torrance Seniors 15, San Pedro 29. Torrance juniors 8, Narbonne 36. Speedball Torrance Ties 13, vs. No Ties 18. Tennis Narbonne vs. Torrance, 6-1, 4-6, 6-4, in favor of Narbonne. The teams were : Sapbamarer: May Guy Elsie Price Rose Higgins Norma McCormack Edith Stevens Mary Whalin Betty Danford Inez Smith Pearl Gilbert No Tier: Isabel Burdick Bernice Baker Frankie Cook Dorothy McMillan Connie Hudson Mary Ogata Kathryn Mitchel Sadao Wadamoto Page Ninety Basketball funiorr: .fmiarrz Ruth Nelson Helen McMaster Evelyn Colburn Kathryn Fritz Lucille Thompson Hortense Price Ruth Wilhelm Rose Agapito Virginia Turner Olga Jaunsem Blanche Lukcs Florence Gramling Aldine Brown Mary Nady jean Wheaton Trixie Rowell Margaret Condon Irene Fix Speedball Tier: Virginia Mikelson Lorraine Roelofs Vivian Young Ula Paisley America Hadler Barbara Nickerson Ruth Arnlin Patricia Carlin Margery Roelofs Esther Terry Ruth Granger Shizuko Kazama Haruko Minami Joy Heglie Elizabeth Neelands Torrance: Laura Scrvaas Emily Bechtel Dolores King Nadine Sherwin Margaret Kibbc Marie Batsch Audrey Clark Vivian Carroll Jean Solomon Jeannette Mikelson Thelma Dilthey janet Mastri Olive Belle Huber Tennis : Lola Cokely Dorothy McMillan TORRANCE HIGH SCHOOL '5"5a?r?tIy2yIe!'t!eZ+F!+!+fieifieeleif!e!e!s+!eIHeIfieeieleleHeirs!firIelrfifle!s+is+!rIeIeZeZeZeZffiffZeZe5sfZ+IeielelgfeisrHel- Calendar August 31: School again! Some were here at 7:30 A.M. for the sleepy janitor to let in. Well, Cleta, Dorothy, and Blanche, it looks as if you could be here on time for the first day at least. September 3: Special Assembly. Yes, Mr. Wood, we'll be good and obey all rules. Seniors pass Hrst. Oh yeh! September 15: Senior dance at noon. Free. The best attendance in history. September 21: Fire-drill. Yes, Dan Barnard did manage to get out of Public Speak- ing, but if there ever is a fire I am afraid Dan will go up with the smoke. September 26: First Senior sing. Sorry Virgina, but Larrv must sit with the boys for this time. What a mild sweet voice Ruth Banks has! Imagine a rocking chair, and Ruth's sweet, soft voice. September 30: Seniors saw work of photographers. Yes, Elizabeth, he'll do his best. October 7: Rally. Boy! the old spirit is there still, regardless of the past defeats. October 8: First football game of the season. We may have the old spirit, but de- feat is still with us. Cheer up, there's a whole season before us. Senior sweaters came today, and Charles Montague has the honor of wearing his first. October 9: Self Government meeting. Yes, Elmer Munson. you will have to keep Lillian Frazier out of the hall too. Too bad. October 12: Special Assembly. Mese Verdi is a very interesting place, but can you imagine anyone living there? November 12: Mr. Quinn gave us an interesting view of the things that happened "Over There" on Armistice Day some few years ago. November 20: Senior Play. Depression certainly took a vacation for the attendance was great. Didn't Mr. jones fGeorge Lancasterj let out some hidden secrets? The bowery, the bowery, etc. November 23: Miss Raymond certainly gave us a look into the mirror of health, and oh, what a sight some of us did see! Remember you are the only one who can't see the back of your neck. November 24: Play Day at Narbonne. All came home tired after a day of good, clean sports. December 2 : Play Day at Torrance. Weren't the sandwiches good? Ask Pal-Marie and Melvin. Page Ninety-one THE TORCH, NINETEEN THIRTY-TWO Calendar, C ontimzed February 11: Mr. Waldon spoke on "Anti-Cigarette League". The dignified Seniors had to wait patiently while the eighth-grade kiddies rushed for the pamphlets given out by Mr. Waldon. - February 15: Miss Rankins of the Bell Telephone system gave an explanation of the telephone and showed us how to dial a number. Watch out, Stanley, you'll turn one too many numbers and get the wrong blonde. February 16: "Girls! Girls! Girls! Why all the powder puffs and combs?" "Don't you know?" "The new coach has arrived." February 23: Track rally today. Introduced the new coach, who seems to be happy upon being with us. February 24: Senior Leap Year Dance. A few boys helped Tommy today. I guess they just couldn't resist the pleading voices and glances of the girls as they ask "Won't you please go to the Senior dances with me?" February 24: Mr. Tompkins gave us an interesting talk on Indian Life and also ex- plained the sign language. Sorry, Bob, but I don't think the signs you were making to Margery were in the Indian language. February 26: Girls' League installation. Elizabeth Burdick must have had the mumps according to the size of her left jaw. March 2: Frieda Pike gave a very interesting program of picture talking, accompany- ing herself on the piano. Pal-Marie, sobbing softly, had to be led from the assembly as Miss Pike sang "Little Pup." March 4: Safety aud call for 8th, 9th, and 10th grades. Guess we seniors are safe enough. March 7: Bird and Arbor Day assembly. Mr. Merrill, Stanley Sach, Tom McNeil, and Mr. Wood, who by the Way could probably dig a ditch if he would push on the shovel instead of the ground, planted a tree. March 10: When Beauty Lovers and World Friendshippers get together, a good time is surely enjoyed by all. Such was the case, although you would never have recognized Ed Hartwell, who was on the program, unless you saw the ring on his little linger. March 18: Junior Play. Bill Parke is sure some "Daddy", and didn't Ilene Falk make your heart flutter? Good work, juniors, and from the attendance the sen- iors will be lucky to have punch for the prom. March 21-25: Vacation. just look at the tan Bill Lanz brought back from the beach. Page Ninety-two TORRANCE HIGH SCHOOL Calendar, Continued April 5: High School nnals in Oratorical contest. Hurrah for Lendel, we expect great work from you in the future contests. April 9: Girls League. julia Schipper had us all on edge when the teacher kissed his best girl on the-nose. April 13: Varsity Club Review in Aud. I bet that jazz orchestra gets a big salary some of these days. By the way, when Herman played his violin solo, which moved the most? Herman or the violin? April 14: World Friendship Banquet. No, that wasn't thunder you heard about 8:30, only Walking Eagle giving a war whoop. April 20: Seniors took test for driving. I guess they must have looked up past history and found Hartley Cooke's record, so decided they would test all seniors. April 21: Today was Co9cetta's birthday. Miss Mills made two cakes, and her home room had a party. My birthday's tomorrow, Miss Mills! April 26: Baseball Rally. I guess the boys decided they needed a rally after watch ing the girls play outdoor baseball. May 4: Annual Benefit and call. Every seat in the aud was full: now we will have a good annual after all. May 115 The girls went to the mountains, and from the looks of the food and sleep- ing equipment they should have had a truck to carry them up the mountains. Watch tomorrow, Ibet more bedroom slippers will be worn than ever before. May 12 : Latin Club Banquet. Yes, those sheets and nightgowns are supposed to be togas. It looks as if the boys were entering the Olympics of a few years ago. May 13: Varsity Club Dance. Did you see all the boys who have been practicing at the Senior dances showing their stuff? Girls! you can get shoe polish at any neighborhood grocery. May 19: Goodwill program put on by Mrs. Granger and World Friendship Club in aud. May 20: Meeting of District Number Seven, California Scholarhip Federation, at Torrance. May 25: Agriculture assembly. If we can't run a mile, or make a goal, there are some of us that can look at a cow and tell if she is perfect or not. May 27:junior-Senior Prom. Every little thing turned out perfect, and all went home tired but happy. You don't have to go to the Olympic games now, do you? Page Ninety-Three THE TORCH, NINETEEN THIRTY-TWO igxgf :g'f'g'n'n'l'n'n'--'nk-'n'nvnvn0,vmfnvnQnvnfnvnvn'nvn'nfn'A-1421.-L-vmvnfnvnfnvnfi.'nQ..sn1nfnvnvL'n'mnannrnfnrny. 1' rwr-v rw- r'v'r vw-v f 4-'rr uv'r'a"r r www-' - . wvv'r'r's"rv'rr-rr wv'rr-r'a-- ' W 'r'z"x" Calendar, Continued June l: G.A.A. Banquet. june 3: Modes in Manners reception. Sorry, boys, there isn't any hammock in our old fashioned garden, as there is at the Misses jones'. June 8: Lettermen's assembly. I wonder where some of those boys will put theit let- ters, there is no more room left on the senior sweaters. June 10: Key Club Banquet. Either bring your girl or a quarter. Do you think that fair, girls, classifying us so cheap? june 13: Alumni Day. Even if they were glad to graduate, all were glad to come back to school again and visit their dear teachers and view the campus. June 14: Senior Class Day. Enough said. June 16: Commencement. Some were glad, others sad, but, nevertherless, all were more than pleased to say "thank you" as they received their diplomas. My Dreams The snow-capped mountains a distance away Remind me of places I long to stray, The sparkling brooks, so crystal and deep, Where baby trout play and sleep Lazily lying beneath large fir trees. Ah! to be in this land of dreams! VIRGINIA MIKELSON, B-11 Page Ninety-Four TORRANCE HIGH SCHOOL faaf.+:+:f:fzazazszszfmm'AA'--:f:e'm--'-e'e:+:+:+:+:M'-L. . aazezez-W-'P-'--'Pe:e-:--:-A:H:wswef-sMzA-.w .m .'- W 4 af 3 ur Advertisers 5 fi y x Qweewaalawawwmweaegr This year egj- c5QfK.6.1s3e!. 5. X 5 5 Q N Ffamffggiiiiiimmmi N M NLM? fs! ' ' M, ne- Sf- Q i 3 E especially those advertisers Who have given us their help by advertising in the Annual in spite of the depression, are entitled to our patronage. 'EE BM sd? early x Sandy 8: Scotty Stone 85 Myers A ' E N . 3 W ff AQ J. C. Penny 3 M Lancaster 8: Shidler . E Mayfield Creamery Q G. H. Colburn N 3 Roberts 8: Roberts Q lg Mullin's Garage A W I-Iaydon's Creamery l ' Leather Supply Company ' FQ . M. A. lc C . in First NIjii::2lirBaick O Q" Q Huddlesron's Furniture Company E' fs: Howard Smith Y ' Dominguez Land Corporation ZZ? Schultz 8: Peckham Q Eby's Dry Goods me Poppy Flower Shop Q Adams and Goodman 5 Q ea: Q W LLTDHQMEQ E rj CWI :- V CIA Q 7 9 0 .J 1 . X '- ' 'fix Page Ninety-five THE TORCH, NINETEEN THIRTY-TWO - Has not gone amiss. gg 3 Prove to Eby's the ad ew 'wsnwfwwwz 3' gf gi o 2 5 '-- Eli I Q 43+ kg Q- Eli C -'2' ll? Q.. H? o Q' wg S-re 1-1. 5 VJ B 'v 1 E13 . Jlk JZ 414 :lf il? -gag,-5.4532323514 il? Ili -- up Eli ul. II 'O JL I l CI If Q- in 21- 1 O ll o 9+ I .4 Q g lL if EE 'Es' tn 1' is .2 4: H 44 v-1 w 'le D Il 'I+' H E ll JE Q JL .Ii Bi 11..- us-U-I Buy Your Furniture Now For Z lo P 4 ,Q 'a H . .Il 'N' falmnic: " Tbafx haw 4 fellow fell: when be A jk dacnft buy bi! :ban from "PENNEY" ,. .+R-. -,ff -:w:-wzwz-'z+':A-wfz-'s- Q U 1 il? -.P "4 2' 44 3+ U, Q if -1? H G3 m R EE EE Z Dj in glg R. O O S ala 'i U1 U Qi 1: ' P., P4 Q if :gg gg U7 .. , J. 'T' CD 3' 4 V' as li w 2 El f H 5 me 5 O 2' 'li i PU ' z : 4' ffl 1- ........- Z i FIS H xl Y' I V' Q GU if 2 P1 I 3 5' H 2 Q se - QR I 5 2. E Z " I 9' 1 n .. I Z , 4 Q Q 5 S2 E I B 5 Q P C rf 5 O '11 "' "U G 33" G I 77 p- 2 n U' N F! ' O -f I D 'R P1 I 0 v-1 O af ' 52 cl- I v- : 3.............-.- from 160, what's the difference? l. 6 Florence G.: Yeah, I think it's a lot of foolishness too. gg. J. C. PENNEY CO. ay t , "There's a fly ln my ice cream." 1269 Saffofi AVC' Torrance "Serves him right. Let him freeze todayg yesterday he was in the soup." '3264+2+I4.TFsn.EfF!TIT?ITif'5"flIn!n!T.n5F E LP 1141: Fan farriving latej 1 What's the score? "' George H Colburn Bill Loftus: Nothing to nothing. ' Fan: Good game, eh? Groceries Vegdillz Don't knowg it hasn't started 645 Sartori -2 Q f CALIFORNIA 53 gn ' TORRANCE Dick Watson: How long can a person live without brains? Ruthzl don't knowg how old are oup 22:1lzezezezezezezez::zfz--zwxfzxxezezez Y ' .!...-....-..-..- -.-...-.-....-.-..-..-...-.......-.-...-.-...--.-.-.-....-....!. 2 H. W, ROBERTS E:mbli.rb:d10 Ymrr HUGHENA ROBERTS Q 1 RoBERTs R ROBERTS i E1 Prado Apartments and Dolley Annex . I Office 1221 El Prado,Telcphone 46 W TORRANCE, CALIFORNIA i in-4 :-are :La 1 1-sc: :--I :fe -in :-u-:-:-V:7:W :-.3--1:13 g.--gi. Pagc Ninety-Slx TORRANCE HIGH SCHOOL Ti: : -1 1 -ll Y :111lT-':-I-:f:1:1f 11111 lr!--I-I1 il-I1h:l1l1 it , ' I 2 I I I I I ' I I I THE FIRST NATIONAL BANK OF TORRANCE E F Ybur Home -Bank .fince 1913 I i I 5 3 I ' I I I 4-2 ez.: :C an -I 1 Ja ...a--.-...,.-.......-..............-.-a...:3 v Y v - vee:veve:ve:-A::-::::-e::vev-v-vvev-:v-v DOCTORS Lancaster and Shidlet Pbyricianr and .furgeanr 3 Suggestion to Mr. Wrigley for a radio theme song: "When you gum to the end of the clay." joe: What do you think of my new Melvin: They look pretty well for Bill Mullin fro fair onej: Say, the next time you fail to stop at my signal, Dorothy S. fcoloringj: Sir, hovv I" O 'W P1 ru a-. D rn ik n O 5 ... 'CI UD FY O 0 ..- xv T V7 V IT' ro '1 rn Garland: On your thumb,of course. Lorraine: Can't,it's got a nail in 1t. nfzt -iiz.. -:-nu-u-u---1 1 1 - - I..-..g...g.. --- golf hose? Torrance California the shape theyre in. ri...-...I-..-.m-..-.....m......-...-...-U.-I.-I-I-In .9 I . I "TRUE TO NATURE!" A ? The rich, full flavors of Haydon's Ice T I 11 Pinch you! r Cream are obtained by blending genuine, I I natural flavors with pure, rich cream. I dare you! I Taken from fruits and nuts in their most I I natural state, these flavors never vary. i I They are always "true to nature," T ' HAYDON'S full flavored f , , ICE CREAM , shall I sit? I I ' 1 TWin0aks IHAYDONS wo I 4- -.-..-......-.-...-...-..-.........-.........i. .p.-- ---- .------3-.-I-2---I.-:- I 1 I Stone and Myers I I in:-nr -- -m--u-u-n-u-an-m-up-m-an-nuxmzm I I I I I I aI v I UQ i NI E I 2 I .-Q se I I S U. UI 4 W I n 'i' THE TORCH, NINETEEN THIRTY-TWO -,eve .g..-....-..---.-.-Z. .EEE -- -E ..-.-1-E-5-zf... -..-:-E E-E-E---E--g g WATCHES DIAMONDS , Ianmariw T T YOUR JEWELER T PENS, PENCILS 1503 CABRILLO CLOCKS -i-....-..-....-.......... -..-...-.......- -.-....-..-...........-....-..-...-......,.....-..-...-.........g. ?EfEfEfEftfrhftfofofeiofofoftiriefofole T'!'fT5T:!'f"M"fg, Audrey C.: But she has a line ear fo :ij music. For Better Food! lg Alice G.: Well for goodness sake, At Redyondble P77685 ' whydoesn't she sing with herear then? U .re N ewmfwkir Exim ' Tain't Fair M. A. Newmark ,gc Company "Wouldn't it be disappointing if you Importers and Wholesale Grocers C0P1Cfl Someoncls Palxf and he got 9' 1248-1264 Wholesale street A While You got 9- C? f!EIEIEIEIEIEXf 'If 1IEIEZ5EI+IfIEIeZfI+IfIeelfinirelvi''ififlwhf ,P---I. ----------- M-H+ Ethel: When do you graduate? i I Beans: End of the quarter. I I Ethel: Suprised? 3 Cgmplimmn of L Beans: No, I've been expecting it for 1 l years. l Dominrguea l Land I 2 . I 1 C07'p07'4lW 'W l Mr. Waddingham: Why do you sit l 1 there and scratch your head? l l Tom MC : I'n'I the only one that knows L-.- -.-.......-..- - -- - - -.-..i its itching- Q.--: -f-1:---E --1-:fn-1 1:-.I-I..-.---1 mf--m----1:-E-M-2-2-E. ---- --1 ...P I 1 l E MULLIN S COMPLETE AUTO SERVICE E l TORRANCE, CALIFORNIA I 2053 Torrance Boulevard Phone 320-J E -5.--u-In-w-nu-n-u--m-un-:n--m-- .::I - ---1 -:--- -------- ln-I---I-I-I1l-'I' Page Ninetyreight TORRANCE HIGH SCHOOL 'Q-'Q QQhQYQQ'..'..' '..',,x..vLrLrLeAQAv ,QMQ .Q,.g,,9,.e,.+..Q..Q,.Q..q..Q,.Q.,q..Q Q Q ,Q,,Q..Q Q Q Q Q Q Q Q Q 9 ,Q Q 1 Q .Q Q ,Jar ,v,.Q..4..Q Q . . 'f . A . . cw . wr-r-u-- -- 'v-S--rv-v'FFr'rFFrx"r'FFFFFFFFFFFFFFFFFFfr's"r'x"5ee!''FFfc'vn"2' Schultz 84 Peckham Authorized Dealers Z-5-A TORRANCE, CALIFORNIA LEATHER S WORKERS E SAMPLE CARDS vi, Of Craft and Garment Leather .if 33 SENT ON REQUEST A Ask For Tool Catalog No 15 , .f - LEATHER SUPPLY COMPANY "' 3. 1012 Broadway Place A Los Angeles .:. iieei-!iHF!nIninInI1 fEFF?tlniflnhininlninietrrflnigf ' Margery: Set the alarm for two, please. Bernie: You and who else? RY944wW?? ??M'WwN'?I'WI"ININ1' ' I Gb ll it SAND Y 84 Hi an fr '19 if SC ZO I I Y it :la ZF fy? 41? 'P aa Io Satisfactory Menis Wear fiE"i"i"i"!"5"2"I"Z"5"i"'Q"5''5"5"I"!+'Z"Z"Z"I"2"!'4"Z"Z"I'4"3 PHONE 137 And for the interior decorator song: just One more Chintz, Torrance has great need for dorm- itories so that the students will be able to arrive on time for the first period. What's the matter, Kitty? Tom McNeil: What's the matter with Bill? Leo: Too conceited. The other clay he bought the book: "What a Million Women Want" to see if they'd spelled his name correctly. Mr. Thurman: l can't understand him, I had a row with him yesterday and called him everything under the sun, but he didn't take a bit of notice, Mr. Fields: He wou1dn'tg he's an um- pire. Pete Z. : How is it you are always out when I call? Bernice B.:,Iust luck. Page niuetv nine THE TORCH, NINETEEN THIRTY TWO ,:,,z6,1. J, ,L .:,+i!viZw. I z, ,f,.y, .f,.e, ,v. ,e, ,f, ,Q, 1, ,L J. 4, ,L ,o, 4, .e, 4. J, ,vnynonein.qJL'JLz..g..1..savnvneaq,,ynvJJaug,:,,:,,:H:a:eqee:.+..4 .1 ..... 'IM-I-l-ra-n-In-u-,-n--u-u-::,,,: ,,:ff-: f-:iz , :-.e-:::f:-n::f:---uu-m- ---. -me-un-2 ! LET FLOWERS .YAY THAT YOU REMEMBER l l Poppy Flower Shop i HAGGARUS Q I Flowers by Wire Post and Cravens Phone 307 i Oi'-lrmruxuzm-u -H11-n-u1n1l1n1u-u-: --'n::-u- -:Y: -471: : : :- n--:,::fuln ADAMS GOGDMAN co. mc. We are sure to have what jg you need in sporting goods Z Wholesale prices for all T Torrance High School Students Qui 1041 .fauib Broadway L01 Angler, Calif. .32 SPORTS HEADQUARTERS 51 44442 ii 'I 'fffielf f'QIf?4H?ieIf?3eIE!e eZeIn!+24HH211221 f:"z6:?:?!::g:W!'?:4:?!Wr'iffzfzi f!fZ'niffiff!rf5e!e'i+rZ"P ' 1.-u :Q ::Y,:7:-an---uf:-u : -: : 1 Y:--:-fl-l : :-vi-I :::-YI-:iz-I-e-ng l ll T - - ll 3 will build a strong, healthy body 3 n , I I as you bu,1ld a store of knowledge. ' s I l I X r 1 IS ' l 1 ' - Ami 1 1 if U :gl g . 1 'X I I f "It's Good" I I X I 'X I Q I I ' I 5 Mayfair Creamery, Ltd. 3 I I f 1326 Post Avenue E f I I I Torrance, California I 1 l l ! 'I' .g..-....,,... ....,... .- -.,.- ... - ... .. -,.-..-.-.....- .. - - .. - - -,-..-,..,.,.,.. Page One Hundred gi QMYK , , K. ig mfW Slgnatures ,Q Q f . 3? E , . 0 5gd'Q . '25 ,2jf,-,iff ,614 ,A,. A the Kdfrrgv V 167 :ff 1vi,CJ-.Alf I we V54 y , ' 'QLMQL 7'Q.Lf,v , if 'Mfg Lfcn ,fyfifff , Q Nj if H I W A if Qwwiwyy Wfff-55 Gif 71 ,, 0 rw , -I JM AU? if Q, ff 2. . , ' '56 , U x, Q J' J LL - Q ' ,Q 6 A 157 5,21 d 1 ,q,. ,K ,447 Cr Q: f, 20 ,Q ' ZZ M fjgfff' WM! ' f9+e!'fAb fag., 17 x ' W! 'XV ,K Q fy 4 L gsm ' wwf , I l '7' A I Z5M75ifQQHsj , 'L , ' . t - M l,,?frf,77fL2??fQ4f , . , awww X Qi Tb 3 , A -' A flfn, A 212 22 I-'MJ Ujgyhjff-1 UL-Iva 'gg 9 ' , . -in GP 2'-'Janis '11,-mfr .N lg L? of kqffif 'N Kay' 8' .Z ' S., .A 9:71 mc? 'wiv . lA2Jf"' Aug 'rr 1 ,s,. AFV K PIX' Kaine' 'YC' r KJ . Il A zjyylg I ' Qxaigw ' ' 1' 1 1 -F, n Nrf' .gn fi ' jf, L1 4X f Nbaii, R' A 15" '- L Aff b .1 cf KJ 5' 'I 'P "Af I N31 '-"Y" it 5 f V ..? -' 'V Ah. .Af '- , :A f' , ' ' ff' ,,-fl' I--,+ M " ' x,,..,.i' Q ' 5,1g'T'r ' V - , N ,f . .f A , ,' ' V , Y r j-,J K. .V 5 ",. , - - - W W zu- - x ,. xx , s. .ff A -'W K- -,",L" fl-"1 "' 'Q . . . f f ,ff-' V' ,' '91, I ' 'J ff .. J .x ' C' K' 5 .I U1 rf, 2 L - ' xx .-7 X-f" nfK'i,"'1 BX, 4 gfdxiwy ff if fig' f J I K , .F '- Lg.-1 I Qi- I fr, --ff", 1 X' ZV 90 ff! .2 YLJ HX! ,. Lf- - If QV Vi f 523 . 'T . ' 4 Lk 5 2, ' - -uf ff, ' fi 1711! ii l-T A ,. Q7 4:1 1 4, ,f li,ff'H h V 25 vin . X :Q I j,gff- -76412, , fgffk-zg, .59-fx l uf! " -- f I fqz , , ' "MQ" ff i ,fr K' fs Ai s . 1,4 l I 1 .,f!!ffJ.Rf!- 6321! K QQ EE Sq Q ef ,LLAVYQ1 y PQ f QQ' f 70' H171 QF Fx Q5 fx fLQ1Qwi9kg'L.? i E! L15 Q Q Q ,, 'w in 'N Lili V' fpdp gifs-L, 5556? Q , P' Vg fm .1 I ' ".1,f,., Lolo- 1,-' X. 1- C . flf, S1gna1:urcs - by ' fl Qafvufuw , , L mm M 'f' ,A my-J pub Mi. . X- X X p ,I 1 ,3 GQ 1' fiif!1'Q'V J gd f Q K JM K r 1 ' I. ' :l sl t V QWVP f ' J ' X! fcjxbiyxlf lulxy Llripf . x V .L Q 1 ,A L, U - , A www 00 ,U W2 f I ,, x X df , J , , ,f .J ! 00 fi f , , 1 O ff kg ,Wa 'J J ff ,N J! 'M 4 U 'Alf f 'f V ffl 71 W4 ,X , x ff f , xy' 1 0 AJ , 3 J X X ly J ' 'Iv X 1' 'yf , T ff' fx X, f L" ' , ' yxky 'N J V N V I I , Y Ni Q, A pf ., I 1' f x x N' J ,fc A X X fd yff 5 V, ,771 ,Ef- ,-' A Vwffijfjuy' ' 1 I f 4 'kv 'J " Kbxgi 'ff 4' .-5 I wx " .A PV FNX , X- Q ,Af ' WW x , b X fy - 1 X f 11 . .f X NAA N 'lmao gif A Q Ii R' s fr , I ,KHX Ll M , xv C X trrjdl Q ' 13 I , Q , N ,, X XX ai, r . SW ng U QI, xx, Q W f Mx' bp . G41 H 'Y M 5 f I ' ' fy ff' f' H' 5 1 Cf I ' If V Q .f .f L44 f, f 'V X ' Q , A 74- if , , A x K 1 , ' f , - f -I :Q ,AP Nw IK i flfJ 1 1? Q Jflflyl ffrfl fl A ILILQ, -a?,.a,l l.' - '-'T j' 'ff x A N 'lg' Kai ,. K , Lk, A 1- ,:,' ,A 'I 4' , 'ELEM cL1'T75',777'Lf"z' 75 . Signatures MM W W Wm C011 j 250 fQ'ff12f2Jl JW Aww V6 WM Wcflffv ef ,4f3QWJ5wY 6Z,z,fM,4,.' www V , ,M Q , A AL 7LPWffJ fi- QQQQQJL 32,74 , m , Q-11,1 00676 196 of Lkbv Q ' E94 V 6-W6 f gif www Cglfwfwi f F71 X9 "SHIV" ,pr w 1 . V, ' CM ' - KJ. flf f f f, ., . -Y A- 'QLAA' SAO'-744-'14-AQ, , V K J' f fl K ,lf -6 5442!-f A10 M' A JL ,fffmyft ,n,4.1,L..f ..A.4,Q J ,Zag L-44 ffg ff ,-7 ,Q 74 gcY 5.,,.,,.,.fq -'W , Y uxlxllgh ax" ' Cginfofaw ,LH Lwzyuz .VLA b 0Q.01flAfvL,0t.,f ' -6-nnjy 69018 fr Mx 1 MQ U4j,WM7QM4nWV,,:. 'YVI.QfffffiL6Wa4f-L x WMM? VJXMWWZKKKWWWWW K l Jawa! 7i,,,.,z4W Rosa Ak? Heh - 4' LQ 68 if Q H lg IZ? x 6 D Q. N Y' - we 56-U" ,a ,iXF,q'.: I x,X . XX 5 'Q :K 6' 'Nr' 5' , sl! BMJ, , AXIS,-:. R 'Und' 2, v 'UN- mm .53 -fy 48- YI


Suggestions in the Torrance High School - Torch Yearbook (Torrance, CA) collection:

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1927 Edition, Page 1

1927

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1928 Edition, Page 1

1928

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1929 Edition, Page 1

1929

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1934 Edition, Page 1

1934

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1935 Edition, Page 1

1935

Torrance High School - Torch Yearbook (Torrance, CA) online yearbook collection, 1936 Edition, Page 1

1936

1985 Edition, online yearbooks, online annuals 1970 Edition, online yearbooks, online annuals 1972 Edition, online yearbooks, online annuals 1965 Edition, online yearbooks, online annuals 1983 Edition, online yearbooks, online annuals 1983 Edition, online yearbooks, online annuals
FIND FRIENDS AND CLASMATES GENEALOGY ARCHIVE REUNION PLANNING
Are you trying to find old school friends, old classmates, fellow servicemen or shipmates? Do you want to see past girlfriends or boyfriends? Relive homecoming, prom, graduation, and other moments on campus captured in yearbook pictures. Revisit your fraternity or sorority and see familiar places. See members of old school clubs and relive old times. Start your search today! Looking for old family members and relatives? Do you want to find pictures of parents or grandparents when they were in school? Want to find out what hairstyle was popular in the 1920s? E-Yearbook.com has a wealth of genealogy information spanning over a century for many schools with full text search. Use our online Genealogy Resource to uncover history quickly! Are you planning a reunion and need assistance? E-Yearbook.com can help you with scanning and providing access to yearbook images for promotional materials and activities. We can provide you with an electronic version of your yearbook that can assist you with reunion planning. E-Yearbook.com will also publish the yearbook images online for people to share and enjoy.